Incidental Mutation 'R5723:Tusc3'
ID452332
Institutional Source Beutler Lab
Gene Symbol Tusc3
Ensembl Gene ENSMUSG00000039530
Gene Nametumor suppressor candidate 3
Synonyms
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.655) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location39005845-39165114 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 39071497 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 230 (G230D)
Ref Sequence ENSEMBL: ENSMUSP00000148134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167992] [ENSMUST00000169034] [ENSMUST00000209440] [ENSMUST00000211241]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167992
AA Change: G230D

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000126080
Gene: ENSMUSG00000039530
AA Change: G230D

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
Pfam:Thioredoxin 64 185 3.7e-7 PFAM
Pfam:OST3_OST6 179 329 1.6e-63 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169034
SMART Domains Protein: ENSMUSP00000129916
Gene: ENSMUSG00000039530

DomainStartEndE-ValueType
signal peptide 1 41 N/A INTRINSIC
PDB:4M90|A 44 102 7e-38 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000209440
AA Change: G230D

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209970
Predicted Effect probably benign
Transcript: ENSMUST00000210890
Predicted Effect probably benign
Transcript: ENSMUST00000211241
Meta Mutation Damage Score 0.27 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a candidate tumor suppressor gene. It is located within a homozygously deleted region of a metastatic prostate cancer. The gene is expressed in most nonlymphoid human tissues including prostate, lung, liver, and colon. Expression was also detected in many epithelial tumor cell lines. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Stat5a A G 11: 100,882,074 H692R probably benign Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Tusc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01730:Tusc3 APN 8 39164839 makesense probably null
IGL03247:Tusc3 APN 8 39130777 missense possibly damaging 0.64
R0070:Tusc3 UTSW 8 39063267 missense possibly damaging 0.49
R0594:Tusc3 UTSW 8 39096968 missense probably damaging 1.00
R1648:Tusc3 UTSW 8 39046567 nonsense probably null
R3615:Tusc3 UTSW 8 39164838 missense probably damaging 0.97
R3616:Tusc3 UTSW 8 39164838 missense probably damaging 0.97
R5502:Tusc3 UTSW 8 39130793 nonsense probably null
R5753:Tusc3 UTSW 8 39096946 missense probably damaging 1.00
R6004:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R6030:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R6030:Tusc3 UTSW 8 39071406 missense probably damaging 0.99
R7162:Tusc3 UTSW 8 39126587 missense probably benign 0.00
R7483:Tusc3 UTSW 8 39071481 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATGTGAAGAGAATACTGACTGTC -3'
(R):5'- TGGAATGTGTCACATACTAGAGTC -3'

Sequencing Primer
(F):5'- ACACGCATTGTATGTAGTTCTCAGG -3'
(R):5'- GAAGAAATCATACCCATAGCTTAAGC -3'
Posted On2017-01-03