Incidental Mutation 'R5723:Stat5a'
ID452341
Institutional Source Beutler Lab
Gene Symbol Stat5a
Ensembl Gene ENSMUSG00000004043
Gene Namesignal transducer and activator of transcription 5A
SynonymsSTAT5
MMRRC Submission 043341-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5723 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location100859351-100885169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100882074 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 692 (H692R)
Ref Sequence ENSEMBL: ENSMUSP00000102980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000103114] [ENSMUST00000107356] [ENSMUST00000107357] [ENSMUST00000127638]
Predicted Effect silent
Transcript: ENSMUST00000004145
SMART Domains Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103114
SMART Domains Protein: ENSMUSP00000099403
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 138 319 7.2e-62 PFAM
Pfam:STAT_bind 321 574 5.7e-130 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect silent
Transcript: ENSMUST00000107356
SMART Domains Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 138 330 6.9e-58 PFAM
Pfam:STAT_bind 332 583 2.4e-101 PFAM
SH2 587 688 7.64e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107357
AA Change: H692R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: H692R

DomainStartEndE-ValueType
STAT_int 2 126 4.42e-62 SMART
Pfam:STAT_alpha 141 330 4.5e-57 PFAM
Pfam:STAT_bind 332 582 1e-104 PFAM
SH2 587 688 1.55e-6 SMART
low complexity region 713 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127638
SMART Domains Protein: ENSMUSP00000120152
Gene: ENSMUSG00000004040

DomainStartEndE-ValueType
STAT_int 2 122 3.03e-60 SMART
Pfam:STAT_alpha 141 319 6.8e-59 PFAM
Pfam:STAT_bind 321 573 2.5e-80 PFAM
SH2 582 663 2.84e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154087
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T C 11: 109,953,619 D862G possibly damaging Het
Abcg2 C T 6: 58,678,351 Q109* probably null Het
Acbd7 A G 2: 3,340,418 Y33C probably damaging Het
Actl7a A G 4: 56,744,310 D279G probably damaging Het
Akr1c18 A T 13: 4,144,329 Y110* probably null Het
Akt1 T C 12: 112,657,270 K276E probably damaging Het
Bcas2 A G 3: 103,177,292 probably benign Het
C9 T A 15: 6,486,816 Y367N probably damaging Het
Cd163 A G 6: 124,319,063 T789A probably benign Het
Cers6 T A 2: 69,108,445 S344T probably benign Het
Clcn4 A G 7: 7,291,682 V329A probably damaging Het
Crisp3 A C 17: 40,235,913 V38G probably damaging Het
Cyp2b23 A G 7: 26,681,396 F135L probably benign Het
Ddr2 A T 1: 169,988,520 C539* probably null Het
Efna5 T A 17: 62,607,463 D189V probably damaging Het
Endov G T 11: 119,499,849 V70F probably damaging Het
Fam49b A T 15: 63,956,598 probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Frem3 A T 8: 80,613,397 H773L probably benign Het
Gm43302 T A 5: 105,217,486 Q552L possibly damaging Het
Gramd1a A T 7: 31,134,483 W506R probably damaging Het
Hmcn1 C T 1: 150,694,849 V2188I possibly damaging Het
Ifit1bl2 A G 19: 34,620,058 F53L probably benign Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Kif5a GGGTTGGT GGGT 10: 127,231,029 probably null Het
Krt16 A G 11: 100,248,446 Y149H probably damaging Het
Krtap5-2 A T 7: 142,175,005 C313S unknown Het
Mreg A G 1: 72,162,368 I155T probably damaging Het
Nans T C 4: 46,499,083 F130S probably benign Het
Nox4 T C 7: 87,304,973 probably benign Het
Olfr178 A T 16: 58,889,613 Y202* probably null Het
Olfr411 C A 11: 74,347,128 W32L possibly damaging Het
Olfr600 A T 7: 103,346,619 M103K possibly damaging Het
Olfr679 C A 7: 105,091,102 C179F probably damaging Het
Pkd1 A G 17: 24,565,523 T348A probably benign Het
Poteg T C 8: 27,449,992 probably null Het
Prom1 T G 5: 44,014,894 N585T probably benign Het
Rfc1 T C 5: 65,277,426 S666G probably null Het
Rilp A G 11: 75,512,861 probably benign Het
Serpina3i A G 12: 104,265,500 E132G probably benign Het
Serpina3m T C 12: 104,393,911 V414A probably damaging Het
Sfrp4 T C 13: 19,623,698 F89S probably damaging Het
Tex29 A T 8: 11,854,279 probably benign Het
Tmc5 T A 7: 118,672,193 F910I probably damaging Het
Tmem8 CGGGG CGGGGG 17: 26,120,562 probably null Het
Tusc3 G A 8: 39,071,497 G230D possibly damaging Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Upb1 A T 10: 75,428,271 I184F probably damaging Het
Vamp4 T C 1: 162,574,363 F5L possibly damaging Het
Zfp583 C A 7: 6,323,675 Q68H probably damaging Het
Zfp831 A C 2: 174,645,407 H625P probably benign Het
Zfp941 G A 7: 140,812,850 probably benign Het
Other mutations in Stat5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Stat5a APN 11 100881072 missense probably damaging 1.00
IGL02021:Stat5a APN 11 100883889 missense probably damaging 1.00
IGL02032:Stat5a APN 11 100861828 missense probably damaging 0.99
IGL03108:Stat5a APN 11 100863139 nonsense probably null
IGL03160:Stat5a APN 11 100861845 missense possibly damaging 0.71
hohum UTSW 11 100874129 missense probably damaging 1.00
R8176_stat5a_357 UTSW 11 100876863 missense probably damaging 1.00
yawn UTSW 11 100879693 missense possibly damaging 0.50
R0098:Stat5a UTSW 11 100875626 missense probably damaging 0.98
R0362:Stat5a UTSW 11 100882083 missense probably benign 0.01
R0452:Stat5a UTSW 11 100863135 missense probably benign 0.20
R0520:Stat5a UTSW 11 100861426 missense probably damaging 0.98
R0815:Stat5a UTSW 11 100875082 splice site probably null
R1081:Stat5a UTSW 11 100881060 missense probably damaging 1.00
R1752:Stat5a UTSW 11 100884058 makesense probably null
R1774:Stat5a UTSW 11 100879286 missense probably damaging 1.00
R1868:Stat5a UTSW 11 100874129 missense probably damaging 1.00
R2152:Stat5a UTSW 11 100874090 missense probably benign 0.38
R2900:Stat5a UTSW 11 100874131 missense probably benign 0.18
R4023:Stat5a UTSW 11 100874926 nonsense probably null
R4791:Stat5a UTSW 11 100865463 missense probably damaging 1.00
R5396:Stat5a UTSW 11 100880583 missense probably damaging 1.00
R5641:Stat5a UTSW 11 100876808 missense probably benign 0.01
R5896:Stat5a UTSW 11 100877057 missense possibly damaging 0.94
R6026:Stat5a UTSW 11 100880316 missense probably damaging 1.00
R7052:Stat5a UTSW 11 100879285 missense probably damaging 1.00
R7075:Stat5a UTSW 11 100879693 missense possibly damaging 0.50
R7568:Stat5a UTSW 11 100875024 missense possibly damaging 0.74
R7771:Stat5a UTSW 11 100863219 missense probably benign 0.34
R7801:Stat5a UTSW 11 100880317 missense probably damaging 1.00
R7814:Stat5a UTSW 11 100875027 missense probably damaging 1.00
R7856:Stat5a UTSW 11 100883902 missense unknown
R8176:Stat5a UTSW 11 100876863 missense probably damaging 1.00
R8234:Stat5a UTSW 11 100879303 missense possibly damaging 0.59
R8680:Stat5a UTSW 11 100883888 missense unknown
R8923:Stat5a UTSW 11 100880482 missense
Predicted Primers PCR Primer
(F):5'- ACTGGGAAATGTGGCTTAAGC -3'
(R):5'- TCTGGATGCTTTTGTACCTCAAG -3'

Sequencing Primer
(F):5'- GATTCAACTGTCCTGGGATAGCAC -3'
(R):5'- TGTACCTCAAGAATCTAGCCTGAGG -3'
Posted On2017-01-03