Incidental Mutation 'R5724:Tasp1'
ID452360
Institutional Source Beutler Lab
Gene Symbol Tasp1
Ensembl Gene ENSMUSG00000039033
Gene Nametaspase, threonine aspartase 1
Synonyms
MMRRC Submission 043342-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R5724 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location139833480-140066805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140057419 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 5 (K5E)
Ref Sequence ENSEMBL: ENSMUSP00000105706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046656] [ENSMUST00000099304] [ENSMUST00000110079]
Predicted Effect probably damaging
Transcript: ENSMUST00000046656
AA Change: K5E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039546
Gene: ENSMUSG00000039033
AA Change: K5E

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 346 1.1e-50 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099304
AA Change: K5E

PolyPhen 2 Score 0.685 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096907
Gene: ENSMUSG00000039033
AA Change: K5E

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 286 1.1e-46 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110079
AA Change: K5E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105706
Gene: ENSMUSG00000039033
AA Change: K5E

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 348 1.3e-62 PFAM
Meta Mutation Damage Score 0.0769 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display prenatal and early postnatal lethality, reduced body size, impaired suckling behavior, homeotic transformations of the axial skeleton, and cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,032,397 noncoding transcript Het
Adam5 T A 8: 24,804,495 K363* probably null Het
Adamts12 T C 15: 11,286,750 Y814H probably benign Het
Adar G T 3: 89,735,169 G119V probably benign Het
Adprhl2 G T 4: 126,318,076 Q148K probably damaging Het
Atr G T 9: 95,866,588 L395F probably damaging Het
Bahcc1 A G 11: 120,285,366 I1946V possibly damaging Het
Bend4 T A 5: 67,417,941 D199V probably damaging Het
Bpifb1 C A 2: 154,204,792 H77Q probably benign Het
Clca1 T C 3: 145,009,072 T595A probably benign Het
Crebbp A T 16: 4,087,635 probably benign Het
Cxcl16 T C 11: 70,459,164 D12G probably damaging Het
Dnah10 T C 5: 124,742,026 W459R probably benign Het
Dock8 T C 19: 25,122,421 L636P probably damaging Het
Eif2ak3 A G 6: 70,876,840 T197A probably benign Het
Fbxo40 T A 16: 36,970,330 R139S probably benign Het
Fer C A 17: 63,924,157 T301K probably damaging Het
Fgf21 A T 7: 45,615,305 M1K probably null Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gm38706 A T 6: 130,483,000 noncoding transcript Het
H2-Q6 A C 17: 35,425,652 Y139S probably damaging Het
Igkv4-53 A T 6: 69,649,007 Y59N probably damaging Het
Jrkl T C 9: 13,244,886 M257V possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Klhl26 T A 8: 70,451,754 Y468F probably damaging Het
Lamb2 T A 9: 108,480,751 probably null Het
Lcp1 A G 14: 75,226,982 T548A probably benign Het
Lct T A 1: 128,300,336 Q1140L probably benign Het
Lrp2 T G 2: 69,451,382 N3882H probably damaging Het
Magi1 A G 6: 93,680,871 I1126T probably benign Het
Magi1 A G 6: 93,745,701 S399P probably damaging Het
Med16 A G 10: 79,895,409 C825R probably damaging Het
Mtx3 C T 13: 92,847,587 P124L probably damaging Het
Nabp2 C T 10: 128,409,686 probably benign Het
Olfr1467 T A 19: 13,365,151 H174Q possibly damaging Het
Pak4 A T 7: 28,564,580 S244T possibly damaging Het
Pccb C T 9: 100,987,847 V307I probably benign Het
Plekhh2 A G 17: 84,566,805 D506G probably benign Het
Plk4 T C 3: 40,801,046 V26A probably damaging Het
Ppp2r3c A T 12: 55,297,832 M117K probably benign Het
Pspc1 C T 14: 56,778,072 E30K probably benign Het
Reps1 A G 10: 18,114,483 S448G possibly damaging Het
Rnf34 C T 5: 122,866,889 Q241* probably null Het
Sgta A T 10: 81,047,688 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Siglech A G 7: 55,768,545 N87S probably damaging Het
Sptbn1 A G 11: 30,144,113 I392T possibly damaging Het
St18 T A 1: 6,770,950 M21K probably benign Het
Sugp1 C T 8: 70,070,149 R500C probably damaging Het
Tbx3 G A 5: 119,675,603 V235I possibly damaging Het
Toporsl A T 4: 52,611,346 N413I probably damaging Het
Ttc30a2 T C 2: 75,977,730 D146G probably benign Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Zfp60 A G 7: 27,748,333 Y142C probably benign Het
Other mutations in Tasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Tasp1 APN 2 139977618 missense probably damaging 1.00
IGL01476:Tasp1 APN 2 140008773 missense probably benign 0.01
IGL02876:Tasp1 APN 2 139834363 missense probably benign 0.45
PIT4449001:Tasp1 UTSW 2 139910535 missense possibly damaging 0.67
R0352:Tasp1 UTSW 2 139951458 critical splice donor site probably null
R0381:Tasp1 UTSW 2 139951483 missense probably damaging 1.00
R1056:Tasp1 UTSW 2 140008764 missense possibly damaging 0.94
R1350:Tasp1 UTSW 2 140057421 missense probably damaging 1.00
R1836:Tasp1 UTSW 2 139951557 missense probably damaging 1.00
R2005:Tasp1 UTSW 2 139977678 missense probably damaging 1.00
R2129:Tasp1 UTSW 2 140048244 missense possibly damaging 0.75
R2259:Tasp1 UTSW 2 139951506 missense probably damaging 1.00
R2321:Tasp1 UTSW 2 140057412 missense probably benign 0.05
R3700:Tasp1 UTSW 2 139910554 missense probably benign 0.00
R3842:Tasp1 UTSW 2 139951501 missense probably damaging 1.00
R5526:Tasp1 UTSW 2 140008789 missense probably damaging 1.00
R6345:Tasp1 UTSW 2 139951537 missense probably damaging 1.00
R6533:Tasp1 UTSW 2 139834357 makesense probably null
R7723:Tasp1 UTSW 2 139985131 missense probably damaging 1.00
R7796:Tasp1 UTSW 2 140008785 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCCTCAGTGTTGTTCAAAGCAAG -3'
(R):5'- TGTTGCTGGACAGAGATTTAACTTG -3'

Sequencing Primer
(F):5'- CTCAGTGTTGTTCAAAGCAAGAAAAG -3'
(R):5'- GCTGGACAGAGATTTAACTTGTAAAC -3'
Posted On2017-01-03