Incidental Mutation 'R5724:Bpifb1'
ID452361
Institutional Source Beutler Lab
Gene Symbol Bpifb1
Ensembl Gene ENSMUSG00000027485
Gene NameBPI fold containing family B, member 1
SynonymsLPlunc1, von Ebner minor salivary protein, U46068
MMRRC Submission 043342-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5724 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154190818-154220369 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 154204792 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 77 (H77Q)
Ref Sequence ENSEMBL: ENSMUSP00000080501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028987] [ENSMUST00000081816]
Predicted Effect probably benign
Transcript: ENSMUST00000028987
AA Change: H77Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028987
Gene: ENSMUSG00000027485
AA Change: H77Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000081816
AA Change: H77Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000080501
Gene: ENSMUSG00000027485
AA Change: H77Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
BPI1 36 256 3.3e-40 SMART
Pfam:LBP_BPI_CETP_C 331 470 1.6e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123017
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may be involved in the innate immune response to bacterial exposure in the mouth, nasal cavities, and lungs. The encoded protein is secreted and is a member of the BPI/LBP/PLUNC protein superfamily. This gene is found with other members of the superfamily in a cluster on chromosome 20. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background sensitive transmission ratio distortion and increased basal MUC5B production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,032,397 noncoding transcript Het
Adam5 T A 8: 24,804,495 K363* probably null Het
Adamts12 T C 15: 11,286,750 Y814H probably benign Het
Adar G T 3: 89,735,169 G119V probably benign Het
Adprhl2 G T 4: 126,318,076 Q148K probably damaging Het
Atr G T 9: 95,866,588 L395F probably damaging Het
Bahcc1 A G 11: 120,285,366 I1946V possibly damaging Het
Bend4 T A 5: 67,417,941 D199V probably damaging Het
Clca1 T C 3: 145,009,072 T595A probably benign Het
Crebbp A T 16: 4,087,635 probably benign Het
Cxcl16 T C 11: 70,459,164 D12G probably damaging Het
Dnah10 T C 5: 124,742,026 W459R probably benign Het
Dock8 T C 19: 25,122,421 L636P probably damaging Het
Eif2ak3 A G 6: 70,876,840 T197A probably benign Het
Fbxo40 T A 16: 36,970,330 R139S probably benign Het
Fer C A 17: 63,924,157 T301K probably damaging Het
Fgf21 A T 7: 45,615,305 M1K probably null Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gm38706 A T 6: 130,483,000 noncoding transcript Het
H2-Q6 A C 17: 35,425,652 Y139S probably damaging Het
Igkv4-53 A T 6: 69,649,007 Y59N probably damaging Het
Jrkl T C 9: 13,244,886 M257V possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Klhl26 T A 8: 70,451,754 Y468F probably damaging Het
Lamb2 T A 9: 108,480,751 probably null Het
Lcp1 A G 14: 75,226,982 T548A probably benign Het
Lct T A 1: 128,300,336 Q1140L probably benign Het
Lrp2 T G 2: 69,451,382 N3882H probably damaging Het
Magi1 A G 6: 93,680,871 I1126T probably benign Het
Magi1 A G 6: 93,745,701 S399P probably damaging Het
Med16 A G 10: 79,895,409 C825R probably damaging Het
Mtx3 C T 13: 92,847,587 P124L probably damaging Het
Nabp2 C T 10: 128,409,686 probably benign Het
Olfr1467 T A 19: 13,365,151 H174Q possibly damaging Het
Pak4 A T 7: 28,564,580 S244T possibly damaging Het
Pccb C T 9: 100,987,847 V307I probably benign Het
Plekhh2 A G 17: 84,566,805 D506G probably benign Het
Plk4 T C 3: 40,801,046 V26A probably damaging Het
Ppp2r3c A T 12: 55,297,832 M117K probably benign Het
Pspc1 C T 14: 56,778,072 E30K probably benign Het
Reps1 A G 10: 18,114,483 S448G possibly damaging Het
Rnf34 C T 5: 122,866,889 Q241* probably null Het
Sgta A T 10: 81,047,688 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Siglech A G 7: 55,768,545 N87S probably damaging Het
Sptbn1 A G 11: 30,144,113 I392T possibly damaging Het
St18 T A 1: 6,770,950 M21K probably benign Het
Sugp1 C T 8: 70,070,149 R500C probably damaging Het
Tasp1 T C 2: 140,057,419 K5E probably damaging Het
Tbx3 G A 5: 119,675,603 V235I possibly damaging Het
Toporsl A T 4: 52,611,346 N413I probably damaging Het
Ttc30a2 T C 2: 75,977,730 D146G probably benign Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Zfp60 A G 7: 27,748,333 Y142C probably benign Het
Other mutations in Bpifb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Bpifb1 APN 2 154217167 splice site probably benign
IGL01516:Bpifb1 APN 2 154218252 missense probably benign 0.03
IGL02047:Bpifb1 APN 2 154202616 start codon destroyed probably null 1.00
IGL02143:Bpifb1 APN 2 154209929 missense probably benign 0.14
IGL03174:Bpifb1 APN 2 154213049 missense probably damaging 1.00
IGL03263:Bpifb1 APN 2 154215306 missense probably benign 0.03
Ectoplasm UTSW 2 154211581 nonsense probably null
R0058:Bpifb1 UTSW 2 154206540 missense possibly damaging 0.54
R0269:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0617:Bpifb1 UTSW 2 154212947 missense possibly damaging 0.51
R0786:Bpifb1 UTSW 2 154202661 missense probably benign 0.11
R1718:Bpifb1 UTSW 2 154213983 splice site probably null
R3605:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3607:Bpifb1 UTSW 2 154211565 missense possibly damaging 0.78
R3689:Bpifb1 UTSW 2 154209899 missense probably benign 0.42
R3807:Bpifb1 UTSW 2 154214002 missense probably benign 0.25
R3930:Bpifb1 UTSW 2 154215322 missense possibly damaging 0.89
R4024:Bpifb1 UTSW 2 154213046 missense probably damaging 1.00
R4745:Bpifb1 UTSW 2 154211581 nonsense probably null
R4752:Bpifb1 UTSW 2 154216280 intron probably benign
R5505:Bpifb1 UTSW 2 154204779 missense probably benign 0.00
R6281:Bpifb1 UTSW 2 154206465 missense probably damaging 1.00
R7038:Bpifb1 UTSW 2 154202669 missense probably damaging 0.99
R7246:Bpifb1 UTSW 2 154207092 missense probably damaging 1.00
R7540:Bpifb1 UTSW 2 154213111 missense probably damaging 1.00
R7599:Bpifb1 UTSW 2 154214151 missense probably damaging 1.00
R7678:Bpifb1 UTSW 2 154202729 missense possibly damaging 0.74
R7811:Bpifb1 UTSW 2 154206564 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTCAGTGATGGACCTTCAACCC -3'
(R):5'- CTTAGAGGTACCAGTGACACTGC -3'

Sequencing Primer
(F):5'- GGAGCCACTACTATGCTGTC -3'
(R):5'- AGTGACACTGCCTTATGGAC -3'
Posted On2017-01-03