Incidental Mutation 'R5724:Adprhl2'
ID 452366
Institutional Source Beutler Lab
Gene Symbol Adprhl2
Ensembl Gene ENSMUSG00000042558
Gene Name ADP-ribosylhydrolase like 2
Synonyms Arh3
MMRRC Submission 043342-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5724 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 126316047-126321703 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 126318076 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 148 (Q148K)
Ref Sequence ENSEMBL: ENSMUSP00000099677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030658] [ENSMUST00000070132] [ENSMUST00000102616] [ENSMUST00000102617]
AlphaFold Q8CG72
PDB Structure Crystal Structure of mouse ADP-ribosylhydrolase 3 (mARH3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030658
SMART Domains Protein: ENSMUSP00000030658
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 399 2.1e-133 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070132
SMART Domains Protein: ENSMUSP00000070270
Gene: ENSMUSG00000056174

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 25 33 N/A INTRINSIC
low complexity region 60 69 N/A INTRINSIC
low complexity region 72 105 N/A INTRINSIC
Pfam:Collagen 116 168 1.2e-9 PFAM
low complexity region 207 237 N/A INTRINSIC
internal_repeat_1 240 259 1.3e-7 PROSPERO
low complexity region 260 327 N/A INTRINSIC
low complexity region 342 387 N/A INTRINSIC
internal_repeat_1 388 407 1.3e-7 PROSPERO
low complexity region 408 429 N/A INTRINSIC
low complexity region 440 459 N/A INTRINSIC
low complexity region 471 530 N/A INTRINSIC
low complexity region 545 557 N/A INTRINSIC
C1Q 564 699 2.44e-78 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102616
SMART Domains Protein: ENSMUSP00000099676
Gene: ENSMUSG00000028845

DomainStartEndE-ValueType
Pfam:Tektin 17 398 1.9e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102617
AA Change: Q148K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099677
Gene: ENSMUSG00000042558
AA Change: Q148K

DomainStartEndE-ValueType
low complexity region 2 27 N/A INTRINSIC
Pfam:ADP_ribosyl_GH 31 344 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128188
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151191
Meta Mutation Damage Score 0.6069 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADP-ribosylglycohydrolase family. The encoded enzyme catalyzes the removal of ADP-ribose from ADP-ribosylated proteins. This enzyme localizes to the mitochondria, in addition to the nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,032,397 noncoding transcript Het
Adam5 T A 8: 24,804,495 K363* probably null Het
Adamts12 T C 15: 11,286,750 Y814H probably benign Het
Adar G T 3: 89,735,169 G119V probably benign Het
Atr G T 9: 95,866,588 L395F probably damaging Het
Bahcc1 A G 11: 120,285,366 I1946V possibly damaging Het
Bend4 T A 5: 67,417,941 D199V probably damaging Het
Bpifb1 C A 2: 154,204,792 H77Q probably benign Het
Clca1 T C 3: 145,009,072 T595A probably benign Het
Crebbp A T 16: 4,087,635 probably benign Het
Cxcl16 T C 11: 70,459,164 D12G probably damaging Het
Dnah10 T C 5: 124,742,026 W459R probably benign Het
Dock8 T C 19: 25,122,421 L636P probably damaging Het
Eif2ak3 A G 6: 70,876,840 T197A probably benign Het
Fbxo40 T A 16: 36,970,330 R139S probably benign Het
Fer C A 17: 63,924,157 T301K probably damaging Het
Fgf21 A T 7: 45,615,305 M1K probably null Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gm38706 A T 6: 130,483,000 noncoding transcript Het
H2-Q6 A C 17: 35,425,652 Y139S probably damaging Het
Igkv4-53 A T 6: 69,649,007 Y59N probably damaging Het
Jrkl T C 9: 13,244,886 M257V possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Klhl26 T A 8: 70,451,754 Y468F probably damaging Het
Lamb2 T A 9: 108,480,751 probably null Het
Lcp1 A G 14: 75,226,982 T548A probably benign Het
Lct T A 1: 128,300,336 Q1140L probably benign Het
Lrp2 T G 2: 69,451,382 N3882H probably damaging Het
Magi1 A G 6: 93,680,871 I1126T probably benign Het
Magi1 A G 6: 93,745,701 S399P probably damaging Het
Med16 A G 10: 79,895,409 C825R probably damaging Het
Mtx3 C T 13: 92,847,587 P124L probably damaging Het
Nabp2 C T 10: 128,409,686 probably benign Het
Olfr1467 T A 19: 13,365,151 H174Q possibly damaging Het
Pak4 A T 7: 28,564,580 S244T possibly damaging Het
Pccb C T 9: 100,987,847 V307I probably benign Het
Plekhh2 A G 17: 84,566,805 D506G probably benign Het
Plk4 T C 3: 40,801,046 V26A probably damaging Het
Ppp2r3c A T 12: 55,297,832 M117K probably benign Het
Pspc1 C T 14: 56,778,072 E30K probably benign Het
Reps1 A G 10: 18,114,483 S448G possibly damaging Het
Rnf34 C T 5: 122,866,889 Q241* probably null Het
Sgta A T 10: 81,047,688 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Siglech A G 7: 55,768,545 N87S probably damaging Het
Sptbn1 A G 11: 30,144,113 I392T possibly damaging Het
St18 T A 1: 6,770,950 M21K probably benign Het
Sugp1 C T 8: 70,070,149 R500C probably damaging Het
Tasp1 T C 2: 140,057,419 K5E probably damaging Het
Tbx3 G A 5: 119,675,603 V235I possibly damaging Het
Toporsl A T 4: 52,611,346 N413I probably damaging Het
Ttc30a2 T C 2: 75,977,730 D146G probably benign Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Zfp60 A G 7: 27,748,333 Y142C probably benign Het
Other mutations in Adprhl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Adprhl2 APN 4 126318481 missense probably damaging 1.00
IGL02391:Adprhl2 APN 4 126317908 splice site probably benign
IGL03189:Adprhl2 APN 4 126317294 splice site probably benign
R0139:Adprhl2 UTSW 4 126318154 missense probably damaging 1.00
R0302:Adprhl2 UTSW 4 126317392 missense probably benign 0.00
R0879:Adprhl2 UTSW 4 126316617 missense probably benign
R2008:Adprhl2 UTSW 4 126317344 missense probably benign 0.05
R3789:Adprhl2 UTSW 4 126316751 missense probably damaging 0.96
R5038:Adprhl2 UTSW 4 126317309 missense possibly damaging 0.69
R5058:Adprhl2 UTSW 4 126318445 missense probably damaging 1.00
R6171:Adprhl2 UTSW 4 126317317 missense probably damaging 1.00
R6326:Adprhl2 UTSW 4 126316613 missense possibly damaging 0.58
R7825:Adprhl2 UTSW 4 126321696 unclassified probably benign
R8552:Adprhl2 UTSW 4 126316575 makesense probably null
R9008:Adprhl2 UTSW 4 126316839 missense probably damaging 1.00
R9142:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321567 missense probably damaging 1.00
Z1176:Adprhl2 UTSW 4 126321661 missense unknown
Predicted Primers PCR Primer
(F):5'- TTATAGCCCAGGGAAGAGGC -3'
(R):5'- TGTTGGTACAGGCTCCCTAG -3'

Sequencing Primer
(F):5'- CGAGAGCCGGGCAAACTAC -3'
(R):5'- GCTCCCTAGGCACCTAGC -3'
Posted On 2017-01-03