Incidental Mutation 'R5724:Dnah10'
ID 452372
Institutional Source Beutler Lab
Gene Symbol Dnah10
Ensembl Gene ENSMUSG00000038011
Gene Name dynein, axonemal, heavy chain 10
Synonyms Dnahc10
MMRRC Submission 043342-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5724 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 124802149-124911372 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 124819090 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 459 (W459R)
Ref Sequence ENSEMBL: ENSMUSP00000114593 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058440] [ENSMUST00000141137]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000058440
AA Change: W459R

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000062995
Gene: ENSMUSG00000038011
AA Change: W459R

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 305 878 9.1e-154 PFAM
coiled coil region 1191 1218 N/A INTRINSIC
coiled coil region 1337 1360 N/A INTRINSIC
Pfam:DHC_N2 1374 1782 1.7e-142 PFAM
AAA 1946 2082 2.51e-1 SMART
AAA 2225 2373 6.91e-1 SMART
low complexity region 2444 2464 N/A INTRINSIC
AAA 2567 2720 2.29e-2 SMART
Pfam:AAA_8 2886 3153 9.8e-87 PFAM
Pfam:MT 3165 3502 9.1e-53 PFAM
Pfam:AAA_9 3522 3747 2.3e-90 PFAM
Pfam:Dynein_heavy 3884 4588 7.6e-240 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141137
AA Change: W459R

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114593
Gene: ENSMUSG00000038011
AA Change: W459R

DomainStartEndE-ValueType
low complexity region 63 72 N/A INTRINSIC
low complexity region 80 86 N/A INTRINSIC
coiled coil region 260 282 N/A INTRINSIC
Pfam:DHC_N1 304 607 4.3e-57 PFAM
Pfam:DHC_N1 598 823 1.2e-39 PFAM
coiled coil region 1134 1161 N/A INTRINSIC
coiled coil region 1280 1303 N/A INTRINSIC
Pfam:DHC_N2 1315 1727 7.3e-135 PFAM
AAA 1889 2025 4e-3 SMART
AAA 2168 2316 1.1e-2 SMART
low complexity region 2387 2407 N/A INTRINSIC
AAA 2510 2663 3.6e-4 SMART
Pfam:AAA_8 2829 3096 2.5e-83 PFAM
Pfam:MT 3108 3445 1.2e-50 PFAM
Pfam:AAA_9 3461 3691 6.7e-59 PFAM
Pfam:Dynein_heavy 3821 4532 1.9e-231 PFAM
Meta Mutation Damage Score 0.0822 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. The axonemal dyneins, found in cilia and flagella, are components of the outer and inner dynein arms attached to the peripheral microtubule doublets. DNAH10 is an inner arm dynein heavy chain (Maiti et al., 2000 [PubMed 11175280]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,168,905 (GRCm39) noncoding transcript Het
Adam5 T A 8: 25,294,511 (GRCm39) K363* probably null Het
Adamts12 T C 15: 11,286,836 (GRCm39) Y814H probably benign Het
Adar G T 3: 89,642,476 (GRCm39) G119V probably benign Het
Adprs G T 4: 126,211,869 (GRCm39) Q148K probably damaging Het
Atr G T 9: 95,748,641 (GRCm39) L395F probably damaging Het
Bahcc1 A G 11: 120,176,192 (GRCm39) I1946V possibly damaging Het
Bend4 T A 5: 67,575,284 (GRCm39) D199V probably damaging Het
Bpifb1 C A 2: 154,046,712 (GRCm39) H77Q probably benign Het
Clca3a1 T C 3: 144,714,833 (GRCm39) T595A probably benign Het
Crebbp A T 16: 3,905,499 (GRCm39) probably benign Het
Cxcl16 T C 11: 70,349,990 (GRCm39) D12G probably damaging Het
Dock8 T C 19: 25,099,785 (GRCm39) L636P probably damaging Het
Eif2ak3 A G 6: 70,853,824 (GRCm39) T197A probably benign Het
Fbxo40 T A 16: 36,790,692 (GRCm39) R139S probably benign Het
Fer C A 17: 64,231,152 (GRCm39) T301K probably damaging Het
Fgf21 A T 7: 45,264,729 (GRCm39) M1K probably null Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm38706 A T 6: 130,459,963 (GRCm39) noncoding transcript Het
H2-Q6 A C 17: 35,644,628 (GRCm39) Y139S probably damaging Het
Ift70a2 T C 2: 75,808,074 (GRCm39) D146G probably benign Het
Igkv4-53 A T 6: 69,625,991 (GRCm39) Y59N probably damaging Het
Jrkl T C 9: 13,244,891 (GRCm39) M257V possibly damaging Het
Kat8 G A 7: 127,523,988 (GRCm39) E343K probably damaging Het
Klhl26 T A 8: 70,904,404 (GRCm39) Y468F probably damaging Het
Lamb2 T A 9: 108,357,950 (GRCm39) probably null Het
Lcp1 A G 14: 75,464,422 (GRCm39) T548A probably benign Het
Lct T A 1: 128,228,073 (GRCm39) Q1140L probably benign Het
Lrp2 T G 2: 69,281,726 (GRCm39) N3882H probably damaging Het
Magi1 A G 6: 93,657,852 (GRCm39) I1126T probably benign Het
Magi1 A G 6: 93,722,682 (GRCm39) S399P probably damaging Het
Med16 A G 10: 79,731,243 (GRCm39) C825R probably damaging Het
Mtx3 C T 13: 92,984,095 (GRCm39) P124L probably damaging Het
Nabp2 C T 10: 128,245,555 (GRCm39) probably benign Het
Or5b113 T A 19: 13,342,515 (GRCm39) H174Q possibly damaging Het
Pak4 A T 7: 28,264,005 (GRCm39) S244T possibly damaging Het
Pccb C T 9: 100,869,900 (GRCm39) V307I probably benign Het
Plekhh2 A G 17: 84,874,233 (GRCm39) D506G probably benign Het
Plk4 T C 3: 40,755,481 (GRCm39) V26A probably damaging Het
Ppp2r3c A T 12: 55,344,617 (GRCm39) M117K probably benign Het
Pramel21 A G 4: 143,344,026 (GRCm39) D442G probably benign Het
Pspc1 C T 14: 57,015,529 (GRCm39) E30K probably benign Het
Reps1 A G 10: 17,990,231 (GRCm39) S448G possibly damaging Het
Rnf34 C T 5: 123,004,952 (GRCm39) Q241* probably null Het
Sgta A T 10: 80,883,522 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Siglech A G 7: 55,418,293 (GRCm39) N87S probably damaging Het
Sptbn1 A G 11: 30,094,113 (GRCm39) I392T possibly damaging Het
St18 T A 1: 6,841,174 (GRCm39) M21K probably benign Het
Sugp1 C T 8: 70,522,799 (GRCm39) R500C probably damaging Het
Tasp1 T C 2: 139,899,339 (GRCm39) K5E probably damaging Het
Tbx3 G A 5: 119,813,668 (GRCm39) V235I possibly damaging Het
Toporsl A T 4: 52,611,346 (GRCm39) N413I probably damaging Het
Ubqln3 G A 7: 103,790,674 (GRCm39) P472L probably benign Het
Zfp60 A G 7: 27,447,758 (GRCm39) Y142C probably benign Het
Other mutations in Dnah10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dnah10 APN 5 124,905,667 (GRCm39) missense probably damaging 1.00
IGL00089:Dnah10 APN 5 124,823,680 (GRCm39) missense probably benign 0.01
IGL00471:Dnah10 APN 5 124,871,405 (GRCm39) missense probably damaging 1.00
IGL01336:Dnah10 APN 5 124,852,576 (GRCm39) missense probably damaging 1.00
IGL01339:Dnah10 APN 5 124,854,276 (GRCm39) missense probably damaging 1.00
IGL01372:Dnah10 APN 5 124,856,218 (GRCm39) missense probably damaging 1.00
IGL01572:Dnah10 APN 5 124,861,010 (GRCm39) missense probably damaging 1.00
IGL01634:Dnah10 APN 5 124,898,405 (GRCm39) missense probably damaging 0.98
IGL01649:Dnah10 APN 5 124,809,553 (GRCm39) missense probably damaging 0.97
IGL01676:Dnah10 APN 5 124,880,392 (GRCm39) missense possibly damaging 0.65
IGL01729:Dnah10 APN 5 124,864,529 (GRCm39) missense probably benign 0.10
IGL01757:Dnah10 APN 5 124,845,991 (GRCm39) missense probably benign 0.37
IGL01759:Dnah10 APN 5 124,832,850 (GRCm39) missense probably benign
IGL01767:Dnah10 APN 5 124,820,801 (GRCm39) splice site probably benign
IGL01769:Dnah10 APN 5 124,842,008 (GRCm39) missense possibly damaging 0.63
IGL01805:Dnah10 APN 5 124,860,985 (GRCm39) missense probably damaging 1.00
IGL02090:Dnah10 APN 5 124,866,876 (GRCm39) missense probably damaging 1.00
IGL02162:Dnah10 APN 5 124,881,810 (GRCm39) missense probably damaging 1.00
IGL02312:Dnah10 APN 5 124,896,430 (GRCm39) missense probably damaging 1.00
IGL02347:Dnah10 APN 5 124,910,487 (GRCm39) critical splice acceptor site probably null
IGL02378:Dnah10 APN 5 124,850,131 (GRCm39) missense probably damaging 1.00
IGL02440:Dnah10 APN 5 124,850,883 (GRCm39) missense probably damaging 1.00
IGL02457:Dnah10 APN 5 124,866,860 (GRCm39) missense probably damaging 1.00
IGL02487:Dnah10 APN 5 124,870,916 (GRCm39) missense possibly damaging 0.90
IGL02502:Dnah10 APN 5 124,898,351 (GRCm39) missense probably damaging 1.00
IGL02516:Dnah10 APN 5 124,864,395 (GRCm39) missense probably damaging 1.00
IGL02544:Dnah10 APN 5 124,876,069 (GRCm39) missense probably benign 0.26
IGL02709:Dnah10 APN 5 124,850,809 (GRCm39) nonsense probably null
IGL02740:Dnah10 APN 5 124,903,927 (GRCm39) splice site probably benign
IGL02746:Dnah10 APN 5 124,807,150 (GRCm39) missense possibly damaging 0.55
IGL02803:Dnah10 APN 5 124,875,078 (GRCm39) missense probably damaging 0.99
IGL02900:Dnah10 APN 5 124,878,886 (GRCm39) missense probably damaging 1.00
IGL02957:Dnah10 APN 5 124,840,197 (GRCm39) missense probably benign 0.07
IGL03076:Dnah10 APN 5 124,807,226 (GRCm39) critical splice donor site probably null
IGL03109:Dnah10 APN 5 124,841,950 (GRCm39) missense probably benign 0.10
IGL03181:Dnah10 APN 5 124,825,521 (GRCm39) missense probably damaging 0.99
IGL03185:Dnah10 APN 5 124,894,707 (GRCm39) missense probably damaging 1.00
IGL03199:Dnah10 APN 5 124,894,761 (GRCm39) missense probably benign 0.00
IGL03328:Dnah10 APN 5 124,831,354 (GRCm39) missense probably benign 0.06
frosty UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
H8562:Dnah10 UTSW 5 124,906,593 (GRCm39) missense probably damaging 1.00
I2288:Dnah10 UTSW 5 124,807,164 (GRCm39) missense probably benign
P0019:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
P0037:Dnah10 UTSW 5 124,895,056 (GRCm39) nonsense probably null
PIT4366001:Dnah10 UTSW 5 124,852,588 (GRCm39) missense possibly damaging 0.95
R0004:Dnah10 UTSW 5 124,803,966 (GRCm39) missense probably benign
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0032:Dnah10 UTSW 5 124,877,955 (GRCm39) missense possibly damaging 0.94
R0050:Dnah10 UTSW 5 124,907,808 (GRCm39) missense probably benign 0.00
R0066:Dnah10 UTSW 5 124,840,140 (GRCm39) missense probably benign 0.01
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0164:Dnah10 UTSW 5 124,860,898 (GRCm39) missense probably damaging 1.00
R0196:Dnah10 UTSW 5 124,911,139 (GRCm39) missense possibly damaging 0.80
R0312:Dnah10 UTSW 5 124,873,433 (GRCm39) splice site probably benign
R0321:Dnah10 UTSW 5 124,900,416 (GRCm39) missense probably benign 0.29
R0410:Dnah10 UTSW 5 124,832,799 (GRCm39) missense probably benign
R0480:Dnah10 UTSW 5 124,885,915 (GRCm39) missense probably damaging 1.00
R0531:Dnah10 UTSW 5 124,889,787 (GRCm39) critical splice donor site probably null
R0533:Dnah10 UTSW 5 124,852,314 (GRCm39) splice site probably null
R0599:Dnah10 UTSW 5 124,878,017 (GRCm39) missense probably damaging 1.00
R0686:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0688:Dnah10 UTSW 5 124,824,782 (GRCm39) missense possibly damaging 0.95
R0780:Dnah10 UTSW 5 124,827,876 (GRCm39) missense possibly damaging 0.87
R0968:Dnah10 UTSW 5 124,906,641 (GRCm39) missense probably damaging 0.99
R0989:Dnah10 UTSW 5 124,875,002 (GRCm39) missense probably benign 0.00
R1203:Dnah10 UTSW 5 124,837,078 (GRCm39) splice site probably null
R1248:Dnah10 UTSW 5 124,832,887 (GRCm39) splice site probably benign
R1366:Dnah10 UTSW 5 124,830,390 (GRCm39) missense probably benign 0.41
R1434:Dnah10 UTSW 5 124,852,050 (GRCm39) missense probably benign 0.03
R1436:Dnah10 UTSW 5 124,839,285 (GRCm39) missense probably benign 0.00
R1438:Dnah10 UTSW 5 124,876,009 (GRCm39) missense probably benign 0.25
R1446:Dnah10 UTSW 5 124,866,860 (GRCm39) missense probably damaging 1.00
R1459:Dnah10 UTSW 5 124,820,750 (GRCm39) missense possibly damaging 0.90
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1466:Dnah10 UTSW 5 124,840,160 (GRCm39) missense probably benign
R1479:Dnah10 UTSW 5 124,854,953 (GRCm39) missense possibly damaging 0.71
R1505:Dnah10 UTSW 5 124,831,303 (GRCm39) missense possibly damaging 0.82
R1519:Dnah10 UTSW 5 124,838,016 (GRCm39) missense probably damaging 0.98
R1565:Dnah10 UTSW 5 124,906,678 (GRCm39) missense probably damaging 1.00
R1668:Dnah10 UTSW 5 124,842,626 (GRCm39) missense probably benign 0.00
R1709:Dnah10 UTSW 5 124,837,155 (GRCm39) missense probably damaging 0.99
R1740:Dnah10 UTSW 5 124,850,254 (GRCm39) splice site probably null
R1828:Dnah10 UTSW 5 124,838,343 (GRCm39) missense probably benign 0.00
R1854:Dnah10 UTSW 5 124,881,753 (GRCm39) missense probably damaging 0.99
R1865:Dnah10 UTSW 5 124,909,590 (GRCm39) splice site probably null
R1893:Dnah10 UTSW 5 124,831,381 (GRCm39) missense probably benign 0.13
R1895:Dnah10 UTSW 5 124,835,494 (GRCm39) missense probably benign 0.00
R1906:Dnah10 UTSW 5 124,878,048 (GRCm39) missense probably damaging 1.00
R1953:Dnah10 UTSW 5 124,859,332 (GRCm39) missense probably benign 0.00
R1965:Dnah10 UTSW 5 124,852,267 (GRCm39) missense probably damaging 1.00
R2002:Dnah10 UTSW 5 124,911,052 (GRCm39) missense probably damaging 1.00
R2006:Dnah10 UTSW 5 124,906,651 (GRCm39) missense possibly damaging 0.58
R2037:Dnah10 UTSW 5 124,823,768 (GRCm39) missense probably benign 0.30
R2046:Dnah10 UTSW 5 124,873,405 (GRCm39) missense probably benign 0.25
R2074:Dnah10 UTSW 5 124,891,738 (GRCm39) missense probably damaging 1.00
R2081:Dnah10 UTSW 5 124,852,045 (GRCm39) missense possibly damaging 0.88
R2257:Dnah10 UTSW 5 124,838,301 (GRCm39) missense probably damaging 1.00
R2272:Dnah10 UTSW 5 124,808,530 (GRCm39) missense probably benign 0.00
R2293:Dnah10 UTSW 5 124,896,285 (GRCm39) missense probably damaging 0.97
R2323:Dnah10 UTSW 5 124,819,064 (GRCm39) missense probably damaging 1.00
R2435:Dnah10 UTSW 5 124,839,929 (GRCm39) critical splice donor site probably null
R2571:Dnah10 UTSW 5 124,852,542 (GRCm39) missense probably damaging 1.00
R2898:Dnah10 UTSW 5 124,894,734 (GRCm39) missense probably damaging 1.00
R2937:Dnah10 UTSW 5 124,896,476 (GRCm39) critical splice donor site probably null
R3439:Dnah10 UTSW 5 124,873,322 (GRCm39) missense possibly damaging 0.91
R3548:Dnah10 UTSW 5 124,824,694 (GRCm39) missense possibly damaging 0.50
R3881:Dnah10 UTSW 5 124,850,095 (GRCm39) missense probably benign 0.37
R4015:Dnah10 UTSW 5 124,854,990 (GRCm39) missense probably benign 0.25
R4261:Dnah10 UTSW 5 124,807,201 (GRCm39) missense possibly damaging 0.95
R4277:Dnah10 UTSW 5 124,809,394 (GRCm39) missense probably benign 0.28
R4299:Dnah10 UTSW 5 124,896,989 (GRCm39) missense probably damaging 1.00
R4613:Dnah10 UTSW 5 124,839,933 (GRCm39) splice site probably null
R4651:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4652:Dnah10 UTSW 5 124,806,207 (GRCm39) missense probably benign 0.20
R4664:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4665:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4666:Dnah10 UTSW 5 124,905,536 (GRCm39) missense possibly damaging 0.95
R4691:Dnah10 UTSW 5 124,852,581 (GRCm39) missense probably damaging 1.00
R4755:Dnah10 UTSW 5 124,824,809 (GRCm39) missense probably benign 0.01
R4806:Dnah10 UTSW 5 124,896,408 (GRCm39) missense probably damaging 1.00
R4839:Dnah10 UTSW 5 124,850,196 (GRCm39) missense probably damaging 1.00
R4903:Dnah10 UTSW 5 124,894,812 (GRCm39) missense probably damaging 1.00
R5018:Dnah10 UTSW 5 124,839,260 (GRCm39) missense possibly damaging 0.79
R5101:Dnah10 UTSW 5 124,909,577 (GRCm39) missense possibly damaging 0.51
R5105:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5119:Dnah10 UTSW 5 124,856,322 (GRCm39) missense probably damaging 1.00
R5139:Dnah10 UTSW 5 124,876,024 (GRCm39) missense probably damaging 0.99
R5242:Dnah10 UTSW 5 124,864,484 (GRCm39) missense probably benign 0.00
R5262:Dnah10 UTSW 5 124,862,220 (GRCm39) missense probably damaging 1.00
R5277:Dnah10 UTSW 5 124,905,201 (GRCm39) missense probably damaging 1.00
R5293:Dnah10 UTSW 5 124,868,851 (GRCm39) missense probably benign 0.01
R5322:Dnah10 UTSW 5 124,850,630 (GRCm39) missense probably damaging 1.00
R5371:Dnah10 UTSW 5 124,820,693 (GRCm39) missense probably benign 0.16
R5468:Dnah10 UTSW 5 124,907,557 (GRCm39) missense probably damaging 1.00
R5470:Dnah10 UTSW 5 124,830,232 (GRCm39) missense probably benign
R5587:Dnah10 UTSW 5 124,870,977 (GRCm39) missense probably benign 0.10
R5797:Dnah10 UTSW 5 124,898,450 (GRCm39) missense probably benign 0.00
R5812:Dnah10 UTSW 5 124,824,810 (GRCm39) missense probably benign 0.01
R5846:Dnah10 UTSW 5 124,900,437 (GRCm39) missense possibly damaging 0.80
R5930:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R5961:Dnah10 UTSW 5 124,888,546 (GRCm39) missense probably benign 0.01
R5970:Dnah10 UTSW 5 124,885,793 (GRCm39) missense probably benign
R6021:Dnah10 UTSW 5 124,814,048 (GRCm39) missense probably damaging 1.00
R6043:Dnah10 UTSW 5 124,878,924 (GRCm39) missense probably damaging 1.00
R6073:Dnah10 UTSW 5 124,896,274 (GRCm39) missense probably benign 0.09
R6080:Dnah10 UTSW 5 124,882,961 (GRCm39) missense possibly damaging 0.71
R6093:Dnah10 UTSW 5 124,830,238 (GRCm39) missense probably benign 0.18
R6155:Dnah10 UTSW 5 124,862,239 (GRCm39) missense probably damaging 1.00
R6155:Dnah10 UTSW 5 124,847,663 (GRCm39) missense probably damaging 1.00
R6162:Dnah10 UTSW 5 124,900,382 (GRCm39) missense probably benign 0.02
R6238:Dnah10 UTSW 5 124,820,743 (GRCm39) missense probably damaging 0.97
R6248:Dnah10 UTSW 5 124,871,283 (GRCm39) splice site probably null
R6275:Dnah10 UTSW 5 124,862,248 (GRCm39) missense probably damaging 1.00
R6297:Dnah10 UTSW 5 124,852,144 (GRCm39) missense possibly damaging 0.55
R6388:Dnah10 UTSW 5 124,906,710 (GRCm39) missense probably benign 0.00
R6458:Dnah10 UTSW 5 124,886,333 (GRCm39) missense probably damaging 1.00
R6504:Dnah10 UTSW 5 124,839,846 (GRCm39) missense possibly damaging 0.50
R6518:Dnah10 UTSW 5 124,835,419 (GRCm39) missense probably damaging 0.99
R6627:Dnah10 UTSW 5 124,907,097 (GRCm39) missense probably damaging 1.00
R6701:Dnah10 UTSW 5 124,837,223 (GRCm39) missense probably benign 0.45
R6702:Dnah10 UTSW 5 124,882,869 (GRCm39) missense probably damaging 1.00
R6745:Dnah10 UTSW 5 124,885,876 (GRCm39) missense probably damaging 1.00
R6784:Dnah10 UTSW 5 124,854,890 (GRCm39) missense probably damaging 0.99
R6807:Dnah10 UTSW 5 124,867,064 (GRCm39) splice site probably null
R6932:Dnah10 UTSW 5 124,898,514 (GRCm39) missense possibly damaging 0.75
R7007:Dnah10 UTSW 5 124,864,490 (GRCm39) missense probably damaging 1.00
R7091:Dnah10 UTSW 5 124,893,206 (GRCm39) missense probably benign 0.37
R7138:Dnah10 UTSW 5 124,900,009 (GRCm39) missense probably damaging 1.00
R7144:Dnah10 UTSW 5 124,900,006 (GRCm39) missense probably damaging 0.98
R7231:Dnah10 UTSW 5 124,890,892 (GRCm39) missense probably benign 0.19
R7278:Dnah10 UTSW 5 124,868,855 (GRCm39) critical splice donor site probably null
R7284:Dnah10 UTSW 5 124,909,662 (GRCm39) missense probably benign 0.37
R7322:Dnah10 UTSW 5 124,898,333 (GRCm39) missense probably benign 0.08
R7523:Dnah10 UTSW 5 124,824,803 (GRCm39) missense probably damaging 0.97
R7565:Dnah10 UTSW 5 124,876,095 (GRCm39) missense probably damaging 1.00
R7593:Dnah10 UTSW 5 124,823,608 (GRCm39) missense probably benign 0.21
R7606:Dnah10 UTSW 5 124,894,776 (GRCm39) missense probably benign 0.00
R7835:Dnah10 UTSW 5 124,854,298 (GRCm39) missense probably damaging 1.00
R7898:Dnah10 UTSW 5 124,859,425 (GRCm39) missense probably damaging 1.00
R7972:Dnah10 UTSW 5 124,803,949 (GRCm39) missense probably benign
R7999:Dnah10 UTSW 5 124,802,322 (GRCm39) missense probably benign 0.06
R8017:Dnah10 UTSW 5 124,877,949 (GRCm39) missense probably benign 0.03
R8032:Dnah10 UTSW 5 124,823,676 (GRCm39) missense probably damaging 0.98
R8052:Dnah10 UTSW 5 124,905,575 (GRCm39) missense probably benign 0.00
R8088:Dnah10 UTSW 5 124,831,330 (GRCm39) missense probably benign 0.00
R8169:Dnah10 UTSW 5 124,877,946 (GRCm39) missense probably damaging 1.00
R8178:Dnah10 UTSW 5 124,832,790 (GRCm39) missense probably benign 0.11
R8200:Dnah10 UTSW 5 124,905,524 (GRCm39) missense probably damaging 1.00
R8210:Dnah10 UTSW 5 124,827,858 (GRCm39) missense probably benign 0.29
R8294:Dnah10 UTSW 5 124,859,410 (GRCm39) missense probably damaging 1.00
R8338:Dnah10 UTSW 5 124,909,566 (GRCm39) missense probably damaging 1.00
R8404:Dnah10 UTSW 5 124,850,606 (GRCm39) missense probably damaging 1.00
R8469:Dnah10 UTSW 5 124,813,895 (GRCm39) missense probably damaging 1.00
R8537:Dnah10 UTSW 5 124,893,164 (GRCm39) missense probably damaging 0.97
R8701:Dnah10 UTSW 5 124,803,911 (GRCm39) missense probably benign 0.00
R8723:Dnah10 UTSW 5 124,891,685 (GRCm39) missense probably damaging 0.99
R8770:Dnah10 UTSW 5 124,852,410 (GRCm39) missense possibly damaging 0.94
R8838:Dnah10 UTSW 5 124,842,614 (GRCm39) missense probably benign 0.09
R8879:Dnah10 UTSW 5 124,895,181 (GRCm39) missense probably damaging 1.00
R8928:Dnah10 UTSW 5 124,866,828 (GRCm39) missense probably damaging 0.98
R8932:Dnah10 UTSW 5 124,878,015 (GRCm39) missense possibly damaging 0.96
R8945:Dnah10 UTSW 5 124,891,006 (GRCm39) missense probably damaging 0.99
R8990:Dnah10 UTSW 5 124,814,057 (GRCm39) missense
R9001:Dnah10 UTSW 5 124,852,515 (GRCm39) missense probably damaging 1.00
R9006:Dnah10 UTSW 5 124,820,783 (GRCm39) missense probably benign 0.23
R9060:Dnah10 UTSW 5 124,905,141 (GRCm39) missense probably damaging 1.00
R9085:Dnah10 UTSW 5 124,839,237 (GRCm39) missense
R9133:Dnah10 UTSW 5 124,859,423 (GRCm39) missense probably damaging 1.00
R9155:Dnah10 UTSW 5 124,907,475 (GRCm39) missense probably damaging 0.99
R9220:Dnah10 UTSW 5 124,871,437 (GRCm39) missense probably benign 0.05
R9234:Dnah10 UTSW 5 124,818,989 (GRCm39) missense possibly damaging 0.94
R9264:Dnah10 UTSW 5 124,813,900 (GRCm39) missense probably damaging 1.00
R9266:Dnah10 UTSW 5 124,845,990 (GRCm39) missense probably benign 0.00
R9386:Dnah10 UTSW 5 124,871,507 (GRCm39) critical splice donor site probably null
R9446:Dnah10 UTSW 5 124,823,677 (GRCm39) missense probably damaging 1.00
R9484:Dnah10 UTSW 5 124,900,508 (GRCm39) missense probably damaging 1.00
R9594:Dnah10 UTSW 5 124,907,107 (GRCm39) missense probably damaging 1.00
R9691:Dnah10 UTSW 5 124,852,249 (GRCm39) missense probably damaging 0.98
RF015:Dnah10 UTSW 5 124,895,141 (GRCm39) missense probably damaging 1.00
RF021:Dnah10 UTSW 5 124,854,971 (GRCm39) missense probably damaging 1.00
T0975:Dnah10 UTSW 5 124,840,130 (GRCm39) missense probably benign
U24488:Dnah10 UTSW 5 124,891,044 (GRCm39) missense probably damaging 1.00
X0017:Dnah10 UTSW 5 124,842,761 (GRCm39) missense probably benign 0.22
Z1176:Dnah10 UTSW 5 124,852,419 (GRCm39) missense probably benign 0.11
Z1177:Dnah10 UTSW 5 124,819,019 (GRCm39) missense probably damaging 1.00
Z1177:Dnah10 UTSW 5 124,895,052 (GRCm39) critical splice acceptor site probably null
Z1177:Dnah10 UTSW 5 124,824,683 (GRCm39) missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TTCCTGGCCTTGACACTAAG -3'
(R):5'- AGAGTATTCTGCCAGCATCTG -3'

Sequencing Primer
(F):5'- GACACTAAGTCCCTCTTCTGTC -3'
(R):5'- TTGCAGTCCTGGGGATGAAACC -3'
Posted On 2017-01-03