Incidental Mutation 'R0552:E430018J23Rik'
ID45238
Institutional Source Beutler Lab
Gene Symbol E430018J23Rik
Ensembl Gene ENSMUSG00000078580
Gene NameRIKEN cDNA E430018J23 gene
Synonyms
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127389673-127393629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127392332 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 161 (I161N)
Ref Sequence ENSEMBL: ENSMUSP00000126288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074249] [ENSMUST00000106303] [ENSMUST00000165495]
Predicted Effect probably benign
Transcript: ENSMUST00000074249
AA Change: S149T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000073867
Gene: ENSMUSG00000078580
AA Change: S149T

DomainStartEndE-ValueType
KRAB 22 79 4.43e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106303
SMART Domains Protein: ENSMUSP00000101910
Gene: ENSMUSG00000078580

DomainStartEndE-ValueType
KRAB 22 81 9.25e-28 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165495
AA Change: I161N

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580
AA Change: I161N

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in E430018J23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:E430018J23Rik APN 7 127392036 missense possibly damaging 0.92
IGL01782:E430018J23Rik APN 7 127393304 missense probably benign 0.02
IGL02174:E430018J23Rik APN 7 127392353 missense possibly damaging 0.54
IGL02882:E430018J23Rik APN 7 127392252 missense probably damaging 1.00
IGL03152:E430018J23Rik APN 7 127392297 missense probably damaging 1.00
R1828:E430018J23Rik UTSW 7 127391909 missense probably damaging 1.00
R1843:E430018J23Rik UTSW 7 127391488 missense probably benign 0.32
R1866:E430018J23Rik UTSW 7 127393331 missense probably damaging 1.00
R3429:E430018J23Rik UTSW 7 127391742 missense possibly damaging 0.79
R4433:E430018J23Rik UTSW 7 127393002 missense possibly damaging 0.75
R4933:E430018J23Rik UTSW 7 127393349 missense probably damaging 1.00
R5292:E430018J23Rik UTSW 7 127392487 missense possibly damaging 0.48
R6218:E430018J23Rik UTSW 7 127393409 missense possibly damaging 0.85
R6667:E430018J23Rik UTSW 7 127393423 missense probably benign 0.35
R6712:E430018J23Rik UTSW 7 127392310 missense probably damaging 1.00
R7108:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7214:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7215:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7216:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7313:E430018J23Rik UTSW 7 127391684 missense probably benign 0.23
R7396:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7397:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7398:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7478:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7479:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7480:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7481:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7512:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7652:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7716:E430018J23Rik UTSW 7 127392087 missense probably benign
R7820:E430018J23Rik UTSW 7 127391436 missense possibly damaging 0.84
R7999:E430018J23Rik UTSW 7 127392428 missense probably damaging 0.98
X0022:E430018J23Rik UTSW 7 127393270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGGGTAAAACTCTTCCCACAGTC -3'
(R):5'- GAGTCTGAGCTTTGTCATGGTCTCC -3'

Sequencing Primer
(F):5'- ACAGTCAGGACACTGATGC -3'
(R):5'- TGTCATGGTCTCCCAGCAG -3'
Posted On2013-06-11