Mutagenetix > Incidental Mutation

Incidental Mutation 'R5724:Ubqln3'

452382

Institutional Source

Beutler Lab

Gene Symbol

Ubqln3

Ensembl Gene

ENSMUSG00000051618

Gene Name

ubiquilin 3

Synonyms

4933400K24Rik

MMRRC Submission

043342-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R5724 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

104140623-104143279 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 104141467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 472 (P472L)

Ref Sequence

ENSEMBL: ENSMUSP00000055229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]

AlphaFold

Q8C5U9

Predicted Effect

probably benign
Transcript: ENSMUST00000057254
AA Change: P472L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: P472L

Domain	Start	End	E-Value	Type
UBQ	22	92	1.56e-15	SMART
low complexity region	103	115	N/A	INTRINSIC
low complexity region	120	151	N/A	INTRINSIC
STI1	194	233	4.25e-7	SMART
low complexity region	280	291	N/A	INTRINSIC
low complexity region	313	328	N/A	INTRINSIC
low complexity region	505	515	N/A	INTRINSIC
UBA	619	657	4.22e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138055

SMART Domains

Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

Domain	Start	End	E-Value	Type
transmembrane domain	29	51	N/A	INTRINSIC

Meta Mutation Damage Score

0.0853

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.5%
20x: 93.1%

Validation Efficiency

100% (62/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830408C21Rik	A	T	13: 107,032,397		noncoding transcript	Het
Adam5	T	A	8: 24,804,495	K363*	probably null	Het
Adamts12	T	C	15: 11,286,750	Y814H	probably benign	Het
Adar	G	T	3: 89,735,169	G119V	probably benign	Het
Adprhl2	G	T	4: 126,318,076	Q148K	probably damaging	Het
Atr	G	T	9: 95,866,588	L395F	probably damaging	Het
Bahcc1	A	G	11: 120,285,366	I1946V	possibly damaging	Het
Bend4	T	A	5: 67,417,941	D199V	probably damaging	Het
Bpifb1	C	A	2: 154,204,792	H77Q	probably benign	Het
Clca1	T	C	3: 145,009,072	T595A	probably benign	Het
Crebbp	A	T	16: 4,087,635		probably benign	Het
Cxcl16	T	C	11: 70,459,164	D12G	probably damaging	Het
Dnah10	T	C	5: 124,742,026	W459R	probably benign	Het
Dock8	T	C	19: 25,122,421	L636P	probably damaging	Het
Eif2ak3	A	G	6: 70,876,840	T197A	probably benign	Het
Fbxo40	T	A	16: 36,970,330	R139S	probably benign	Het
Fer	C	A	17: 63,924,157	T301K	probably damaging	Het
Fgf21	A	T	7: 45,615,305	M1K	probably null	Het
Gm11677	C	T	11: 111,724,711		noncoding transcript	Het
Gm13083	A	G	4: 143,617,456	D442G	probably benign	Het
Gm38706	A	T	6: 130,483,000		noncoding transcript	Het
H2-Q6	A	C	17: 35,425,652	Y139S	probably damaging	Het
Igkv4-53	A	T	6: 69,649,007	Y59N	probably damaging	Het
Jrkl	T	C	9: 13,244,886	M257V	possibly damaging	Het
Kat8	G	A	7: 127,924,816	E343K	probably damaging	Het
Klhl26	T	A	8: 70,451,754	Y468F	probably damaging	Het
Lamb2	T	A	9: 108,480,751		probably null	Het
Lcp1	A	G	14: 75,226,982	T548A	probably benign	Het
Lct	T	A	1: 128,300,336	Q1140L	probably benign	Het
Lrp2	T	G	2: 69,451,382	N3882H	probably damaging	Het
Magi1	A	G	6: 93,745,701	S399P	probably damaging	Het
Magi1	A	G	6: 93,680,871	I1126T	probably benign	Het
Med16	A	G	10: 79,895,409	C825R	probably damaging	Het
Mtx3	C	T	13: 92,847,587	P124L	probably damaging	Het
Nabp2	C	T	10: 128,409,686		probably benign	Het
Olfr1467	T	A	19: 13,365,151	H174Q	possibly damaging	Het
Pak4	A	T	7: 28,564,580	S244T	possibly damaging	Het
Pccb	C	T	9: 100,987,847	V307I	probably benign	Het
Plekhh2	A	G	17: 84,566,805	D506G	probably benign	Het
Plk4	T	C	3: 40,801,046	V26A	probably damaging	Het
Ppp2r3c	A	T	12: 55,297,832	M117K	probably benign	Het
Pspc1	C	T	14: 56,778,072	E30K	probably benign	Het
Reps1	A	G	10: 18,114,483	S448G	possibly damaging	Het
Rnf34	C	T	5: 122,866,889	Q241*	probably null	Het
Sgta	A	T	10: 81,047,688		probably null	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Siglech	A	G	7: 55,768,545	N87S	probably damaging	Het
Sptbn1	A	G	11: 30,144,113	I392T	possibly damaging	Het
St18	T	A	1: 6,770,950	M21K	probably benign	Het
Sugp1	C	T	8: 70,070,149	R500C	probably damaging	Het
Tasp1	T	C	2: 140,057,419	K5E	probably damaging	Het
Tbx3	G	A	5: 119,675,603	V235I	possibly damaging	Het
Toporsl	A	T	4: 52,611,346	N413I	probably damaging	Het
Ttc30a2	T	C	2: 75,977,730	D146G	probably benign	Het
Zfp60	A	G	7: 27,748,333	Y142C	probably benign	Het

Other mutations in Ubqln3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00656:Ubqln3	APN	7	104141777	missense	probably benign	0.00
IGL00766:Ubqln3	APN	7	104142824	missense	probably benign	0.00
IGL01451:Ubqln3	APN	7	104142196	missense	possibly damaging	0.71
IGL01673:Ubqln3	APN	7	104142398	missense	probably benign	0.12
IGL01705:Ubqln3	APN	7	104142677	missense	probably damaging	1.00
IGL01988:Ubqln3	APN	7	104142882	utr 5 prime	probably benign
IGL02008:Ubqln3	APN	7	104142316	missense	probably damaging	1.00
IGL02072:Ubqln3	APN	7	104141299	missense	possibly damaging	0.69
IGL02546:Ubqln3	APN	7	104142518	missense	probably benign	0.02
IGL02657:Ubqln3	APN	7	104141963	missense	probably damaging	0.97
IGL02682:Ubqln3	APN	7	104142065	missense	probably benign	0.19
IGL02709:Ubqln3	APN	7	104141336	missense	probably benign	0.12
IGL03357:Ubqln3	APN	7	104142556	missense	probably benign
PIT4544001:Ubqln3	UTSW	7	104141343	missense	probably damaging	0.97
R0180:Ubqln3	UTSW	7	104141840	missense	probably damaging	1.00
R0845:Ubqln3	UTSW	7	104142068	missense	probably damaging	0.98
R1019:Ubqln3	UTSW	7	104141386	missense	probably benign	0.00
R1280:Ubqln3	UTSW	7	104142076	missense	possibly damaging	0.85
R1448:Ubqln3	UTSW	7	104142790	missense	probably damaging	1.00
R1550:Ubqln3	UTSW	7	104141546	missense	probably damaging	0.98
R1617:Ubqln3	UTSW	7	104142860	missense	possibly damaging	0.95
R1650:Ubqln3	UTSW	7	104141021	missense	possibly damaging	0.84
R2060:Ubqln3	UTSW	7	104142151	missense	probably damaging	1.00
R2246:Ubqln3	UTSW	7	104142311	missense	probably damaging	1.00
R2263:Ubqln3	UTSW	7	104141635	nonsense	probably null
R2366:Ubqln3	UTSW	7	104141049	missense	probably damaging	0.99
R4232:Ubqln3	UTSW	7	104141803	missense	probably benign	0.00
R4447:Ubqln3	UTSW	7	104142814	missense	probably benign	0.31
R4509:Ubqln3	UTSW	7	104141444	missense	probably damaging	0.97
R4604:Ubqln3	UTSW	7	104142491	missense	probably benign	0.00
R5416:Ubqln3	UTSW	7	104141672	missense	probably benign	0.34
R5617:Ubqln3	UTSW	7	104142433	missense	probably damaging	0.99
R5648:Ubqln3	UTSW	7	104140910	missense	probably damaging	0.99
R5722:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5723:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5819:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5820:Ubqln3	UTSW	7	104141467	missense	probably benign	0.00
R5966:Ubqln3	UTSW	7	104141699	missense	probably benign	0.03
R6260:Ubqln3	UTSW	7	104142317	nonsense	probably null
R6272:Ubqln3	UTSW	7	104142178	missense	probably damaging	1.00
R6542:Ubqln3	UTSW	7	104141617	missense	probably benign	0.00
R6936:Ubqln3	UTSW	7	104142310	missense	probably damaging	1.00
R7023:Ubqln3	UTSW	7	104141423	missense	probably damaging	1.00
R7025:Ubqln3	UTSW	7	104141275	missense	probably benign	0.01
R7079:Ubqln3	UTSW	7	104141371	missense	probably benign	0.12
R7733:Ubqln3	UTSW	7	104141076	missense	probably damaging	0.98
R7764:Ubqln3	UTSW	7	104141236	missense	possibly damaging	0.52
R7919:Ubqln3	UTSW	7	104141192	missense	probably benign	0.03
R7961:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R8009:Ubqln3	UTSW	7	104142590	missense	probably benign	0.00
R9619:Ubqln3	UTSW	7	104141846	missense	probably benign	0.05
R9652:Ubqln3	UTSW	7	104142755	missense	probably damaging	1.00
RF054:Ubqln3	UTSW	7	104141178	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CAGTAGCCAGAATCTGTAGACCC -3'
(R):5'- AAGGGAAAGTCATCATGCCCAG -3'

Sequencing Primer
(F):5'- AGAATCTGTAGACCCTGCTCAATCTG -3'
(R):5'- CAGCTTTCTTGAGACACTCAACTGAG -3'

Posted On

2017-01-03