Incidental Mutation 'R5724:Ubqln3'
ID 452382
Institutional Source Beutler Lab
Gene Symbol Ubqln3
Ensembl Gene ENSMUSG00000051618
Gene Name ubiquilin 3
Synonyms 4933400K24Rik
MMRRC Submission 043342-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.092) question?
Stock # R5724 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 103789830-103792486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103790674 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 472 (P472L)
Ref Sequence ENSEMBL: ENSMUSP00000055229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057254] [ENSMUST00000138055]
AlphaFold Q8C5U9
Predicted Effect probably benign
Transcript: ENSMUST00000057254
AA Change: P472L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055229
Gene: ENSMUSG00000051618
AA Change: P472L

DomainStartEndE-ValueType
UBQ 22 92 1.56e-15 SMART
low complexity region 103 115 N/A INTRINSIC
low complexity region 120 151 N/A INTRINSIC
STI1 194 233 4.25e-7 SMART
low complexity region 280 291 N/A INTRINSIC
low complexity region 313 328 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
UBA 619 657 4.22e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Meta Mutation Damage Score 0.0853 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and are thus thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This gene is specifically expressed in the testis. It has been suggested that this gene may regulate cell-cycle progression during spermatogenesis, however, it has been shown that the ortholgous mouse gene is dispensable for embryonic development and spermatogenesis. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and developmentally normal with no apparent defects in male fertility or spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,168,905 (GRCm39) noncoding transcript Het
Adam5 T A 8: 25,294,511 (GRCm39) K363* probably null Het
Adamts12 T C 15: 11,286,836 (GRCm39) Y814H probably benign Het
Adar G T 3: 89,642,476 (GRCm39) G119V probably benign Het
Adprs G T 4: 126,211,869 (GRCm39) Q148K probably damaging Het
Atr G T 9: 95,748,641 (GRCm39) L395F probably damaging Het
Bahcc1 A G 11: 120,176,192 (GRCm39) I1946V possibly damaging Het
Bend4 T A 5: 67,575,284 (GRCm39) D199V probably damaging Het
Bpifb1 C A 2: 154,046,712 (GRCm39) H77Q probably benign Het
Clca3a1 T C 3: 144,714,833 (GRCm39) T595A probably benign Het
Crebbp A T 16: 3,905,499 (GRCm39) probably benign Het
Cxcl16 T C 11: 70,349,990 (GRCm39) D12G probably damaging Het
Dnah10 T C 5: 124,819,090 (GRCm39) W459R probably benign Het
Dock8 T C 19: 25,099,785 (GRCm39) L636P probably damaging Het
Eif2ak3 A G 6: 70,853,824 (GRCm39) T197A probably benign Het
Fbxo40 T A 16: 36,790,692 (GRCm39) R139S probably benign Het
Fer C A 17: 64,231,152 (GRCm39) T301K probably damaging Het
Fgf21 A T 7: 45,264,729 (GRCm39) M1K probably null Het
Gm11677 C T 11: 111,615,537 (GRCm39) noncoding transcript Het
Gm38706 A T 6: 130,459,963 (GRCm39) noncoding transcript Het
H2-Q6 A C 17: 35,644,628 (GRCm39) Y139S probably damaging Het
Ift70a2 T C 2: 75,808,074 (GRCm39) D146G probably benign Het
Igkv4-53 A T 6: 69,625,991 (GRCm39) Y59N probably damaging Het
Jrkl T C 9: 13,244,891 (GRCm39) M257V possibly damaging Het
Kat8 G A 7: 127,523,988 (GRCm39) E343K probably damaging Het
Klhl26 T A 8: 70,904,404 (GRCm39) Y468F probably damaging Het
Lamb2 T A 9: 108,357,950 (GRCm39) probably null Het
Lcp1 A G 14: 75,464,422 (GRCm39) T548A probably benign Het
Lct T A 1: 128,228,073 (GRCm39) Q1140L probably benign Het
Lrp2 T G 2: 69,281,726 (GRCm39) N3882H probably damaging Het
Magi1 A G 6: 93,657,852 (GRCm39) I1126T probably benign Het
Magi1 A G 6: 93,722,682 (GRCm39) S399P probably damaging Het
Med16 A G 10: 79,731,243 (GRCm39) C825R probably damaging Het
Mtx3 C T 13: 92,984,095 (GRCm39) P124L probably damaging Het
Nabp2 C T 10: 128,245,555 (GRCm39) probably benign Het
Or5b113 T A 19: 13,342,515 (GRCm39) H174Q possibly damaging Het
Pak4 A T 7: 28,264,005 (GRCm39) S244T possibly damaging Het
Pccb C T 9: 100,869,900 (GRCm39) V307I probably benign Het
Plekhh2 A G 17: 84,874,233 (GRCm39) D506G probably benign Het
Plk4 T C 3: 40,755,481 (GRCm39) V26A probably damaging Het
Ppp2r3c A T 12: 55,344,617 (GRCm39) M117K probably benign Het
Pramel21 A G 4: 143,344,026 (GRCm39) D442G probably benign Het
Pspc1 C T 14: 57,015,529 (GRCm39) E30K probably benign Het
Reps1 A G 10: 17,990,231 (GRCm39) S448G possibly damaging Het
Rnf34 C T 5: 123,004,952 (GRCm39) Q241* probably null Het
Sgta A T 10: 80,883,522 (GRCm39) probably null Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Siglech A G 7: 55,418,293 (GRCm39) N87S probably damaging Het
Sptbn1 A G 11: 30,094,113 (GRCm39) I392T possibly damaging Het
St18 T A 1: 6,841,174 (GRCm39) M21K probably benign Het
Sugp1 C T 8: 70,522,799 (GRCm39) R500C probably damaging Het
Tasp1 T C 2: 139,899,339 (GRCm39) K5E probably damaging Het
Tbx3 G A 5: 119,813,668 (GRCm39) V235I possibly damaging Het
Toporsl A T 4: 52,611,346 (GRCm39) N413I probably damaging Het
Zfp60 A G 7: 27,447,758 (GRCm39) Y142C probably benign Het
Other mutations in Ubqln3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ubqln3 APN 7 103,790,984 (GRCm39) missense probably benign 0.00
IGL00766:Ubqln3 APN 7 103,792,031 (GRCm39) missense probably benign 0.00
IGL01451:Ubqln3 APN 7 103,791,403 (GRCm39) missense possibly damaging 0.71
IGL01673:Ubqln3 APN 7 103,791,605 (GRCm39) missense probably benign 0.12
IGL01705:Ubqln3 APN 7 103,791,884 (GRCm39) missense probably damaging 1.00
IGL01988:Ubqln3 APN 7 103,792,089 (GRCm39) utr 5 prime probably benign
IGL02008:Ubqln3 APN 7 103,791,523 (GRCm39) missense probably damaging 1.00
IGL02072:Ubqln3 APN 7 103,790,506 (GRCm39) missense possibly damaging 0.69
IGL02546:Ubqln3 APN 7 103,791,725 (GRCm39) missense probably benign 0.02
IGL02657:Ubqln3 APN 7 103,791,170 (GRCm39) missense probably damaging 0.97
IGL02682:Ubqln3 APN 7 103,791,272 (GRCm39) missense probably benign 0.19
IGL02709:Ubqln3 APN 7 103,790,543 (GRCm39) missense probably benign 0.12
IGL03357:Ubqln3 APN 7 103,791,763 (GRCm39) missense probably benign
PIT4544001:Ubqln3 UTSW 7 103,790,550 (GRCm39) missense probably damaging 0.97
R0180:Ubqln3 UTSW 7 103,791,047 (GRCm39) missense probably damaging 1.00
R0845:Ubqln3 UTSW 7 103,791,275 (GRCm39) missense probably damaging 0.98
R1019:Ubqln3 UTSW 7 103,790,593 (GRCm39) missense probably benign 0.00
R1280:Ubqln3 UTSW 7 103,791,283 (GRCm39) missense possibly damaging 0.85
R1448:Ubqln3 UTSW 7 103,791,997 (GRCm39) missense probably damaging 1.00
R1550:Ubqln3 UTSW 7 103,790,753 (GRCm39) missense probably damaging 0.98
R1617:Ubqln3 UTSW 7 103,792,067 (GRCm39) missense possibly damaging 0.95
R1650:Ubqln3 UTSW 7 103,790,228 (GRCm39) missense possibly damaging 0.84
R2060:Ubqln3 UTSW 7 103,791,358 (GRCm39) missense probably damaging 1.00
R2246:Ubqln3 UTSW 7 103,791,518 (GRCm39) missense probably damaging 1.00
R2263:Ubqln3 UTSW 7 103,790,842 (GRCm39) nonsense probably null
R2366:Ubqln3 UTSW 7 103,790,256 (GRCm39) missense probably damaging 0.99
R4232:Ubqln3 UTSW 7 103,791,010 (GRCm39) missense probably benign 0.00
R4447:Ubqln3 UTSW 7 103,792,021 (GRCm39) missense probably benign 0.31
R4509:Ubqln3 UTSW 7 103,790,651 (GRCm39) missense probably damaging 0.97
R4604:Ubqln3 UTSW 7 103,791,698 (GRCm39) missense probably benign 0.00
R5416:Ubqln3 UTSW 7 103,790,879 (GRCm39) missense probably benign 0.34
R5617:Ubqln3 UTSW 7 103,791,640 (GRCm39) missense probably damaging 0.99
R5648:Ubqln3 UTSW 7 103,790,117 (GRCm39) missense probably damaging 0.99
R5722:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5723:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5819:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5820:Ubqln3 UTSW 7 103,790,674 (GRCm39) missense probably benign 0.00
R5966:Ubqln3 UTSW 7 103,790,906 (GRCm39) missense probably benign 0.03
R6260:Ubqln3 UTSW 7 103,791,524 (GRCm39) nonsense probably null
R6272:Ubqln3 UTSW 7 103,791,385 (GRCm39) missense probably damaging 1.00
R6542:Ubqln3 UTSW 7 103,790,824 (GRCm39) missense probably benign 0.00
R6936:Ubqln3 UTSW 7 103,791,517 (GRCm39) missense probably damaging 1.00
R7023:Ubqln3 UTSW 7 103,790,630 (GRCm39) missense probably damaging 1.00
R7025:Ubqln3 UTSW 7 103,790,482 (GRCm39) missense probably benign 0.01
R7079:Ubqln3 UTSW 7 103,790,578 (GRCm39) missense probably benign 0.12
R7733:Ubqln3 UTSW 7 103,790,283 (GRCm39) missense probably damaging 0.98
R7764:Ubqln3 UTSW 7 103,790,443 (GRCm39) missense possibly damaging 0.52
R7919:Ubqln3 UTSW 7 103,790,399 (GRCm39) missense probably benign 0.03
R7961:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R8009:Ubqln3 UTSW 7 103,791,797 (GRCm39) missense probably benign 0.00
R9619:Ubqln3 UTSW 7 103,791,053 (GRCm39) missense probably benign 0.05
R9652:Ubqln3 UTSW 7 103,791,962 (GRCm39) missense probably damaging 1.00
RF054:Ubqln3 UTSW 7 103,790,385 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGTAGCCAGAATCTGTAGACCC -3'
(R):5'- AAGGGAAAGTCATCATGCCCAG -3'

Sequencing Primer
(F):5'- AGAATCTGTAGACCCTGCTCAATCTG -3'
(R):5'- CAGCTTTCTTGAGACACTCAACTGAG -3'
Posted On 2017-01-03