Incidental Mutation 'R5724:Pccb'
ID452389
Institutional Source Beutler Lab
Gene Symbol Pccb
Ensembl Gene ENSMUSG00000032527
Gene Namepropionyl Coenzyme A carboxylase, beta polypeptide
Synonyms
MMRRC Submission 043342-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5724 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location100982032-101034898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100987847 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 307 (V307I)
Ref Sequence ENSEMBL: ENSMUSP00000118006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035116] [ENSMUST00000149322]
Predicted Effect probably benign
Transcript: ENSMUST00000035116
AA Change: V344I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035116
Gene: ENSMUSG00000032527
AA Change: V344I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 539 6.2e-197 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149322
AA Change: V307I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000118006
Gene: ENSMUSG00000032527
AA Change: V307I

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 187 2.3e-45 PFAM
Pfam:Carboxyl_trans 183 502 2.7e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149998
Meta Mutation Damage Score 0.1508 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the propionyl-CoA carboxylase (PCC) enzyme, which is involved in the catabolism of propionyl-CoA. PCC is a mitochondrial enzyme that probably acts as a dodecamer of six alpha subunits and six beta subunits. This gene encodes the beta subunit of PCC. Defects in this gene are a cause of propionic acidemia type II (PA-2). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,032,397 noncoding transcript Het
Adam5 T A 8: 24,804,495 K363* probably null Het
Adamts12 T C 15: 11,286,750 Y814H probably benign Het
Adar G T 3: 89,735,169 G119V probably benign Het
Adprhl2 G T 4: 126,318,076 Q148K probably damaging Het
Atr G T 9: 95,866,588 L395F probably damaging Het
Bahcc1 A G 11: 120,285,366 I1946V possibly damaging Het
Bend4 T A 5: 67,417,941 D199V probably damaging Het
Bpifb1 C A 2: 154,204,792 H77Q probably benign Het
Clca1 T C 3: 145,009,072 T595A probably benign Het
Crebbp A T 16: 4,087,635 probably benign Het
Cxcl16 T C 11: 70,459,164 D12G probably damaging Het
Dnah10 T C 5: 124,742,026 W459R probably benign Het
Dock8 T C 19: 25,122,421 L636P probably damaging Het
Eif2ak3 A G 6: 70,876,840 T197A probably benign Het
Fbxo40 T A 16: 36,970,330 R139S probably benign Het
Fer C A 17: 63,924,157 T301K probably damaging Het
Fgf21 A T 7: 45,615,305 M1K probably null Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gm38706 A T 6: 130,483,000 noncoding transcript Het
H2-Q6 A C 17: 35,425,652 Y139S probably damaging Het
Igkv4-53 A T 6: 69,649,007 Y59N probably damaging Het
Jrkl T C 9: 13,244,886 M257V possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Klhl26 T A 8: 70,451,754 Y468F probably damaging Het
Lamb2 T A 9: 108,480,751 probably null Het
Lcp1 A G 14: 75,226,982 T548A probably benign Het
Lct T A 1: 128,300,336 Q1140L probably benign Het
Lrp2 T G 2: 69,451,382 N3882H probably damaging Het
Magi1 A G 6: 93,680,871 I1126T probably benign Het
Magi1 A G 6: 93,745,701 S399P probably damaging Het
Med16 A G 10: 79,895,409 C825R probably damaging Het
Mtx3 C T 13: 92,847,587 P124L probably damaging Het
Nabp2 C T 10: 128,409,686 probably benign Het
Olfr1467 T A 19: 13,365,151 H174Q possibly damaging Het
Pak4 A T 7: 28,564,580 S244T possibly damaging Het
Plekhh2 A G 17: 84,566,805 D506G probably benign Het
Plk4 T C 3: 40,801,046 V26A probably damaging Het
Ppp2r3c A T 12: 55,297,832 M117K probably benign Het
Pspc1 C T 14: 56,778,072 E30K probably benign Het
Reps1 A G 10: 18,114,483 S448G possibly damaging Het
Rnf34 C T 5: 122,866,889 Q241* probably null Het
Sgta A T 10: 81,047,688 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Siglech A G 7: 55,768,545 N87S probably damaging Het
Sptbn1 A G 11: 30,144,113 I392T possibly damaging Het
St18 T A 1: 6,770,950 M21K probably benign Het
Sugp1 C T 8: 70,070,149 R500C probably damaging Het
Tasp1 T C 2: 140,057,419 K5E probably damaging Het
Tbx3 G A 5: 119,675,603 V235I possibly damaging Het
Toporsl A T 4: 52,611,346 N413I probably damaging Het
Ttc30a2 T C 2: 75,977,730 D146G probably benign Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Zfp60 A G 7: 27,748,333 Y142C probably benign Het
Other mutations in Pccb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Pccb APN 9 100985869 missense probably damaging 1.00
IGL02101:Pccb APN 9 100987841 missense possibly damaging 0.53
IGL02149:Pccb APN 9 100985190 missense probably damaging 1.00
IGL02938:Pccb APN 9 100984396 missense probably benign 0.35
PIT4402001:Pccb UTSW 9 100995592 missense probably benign 0.01
R0446:Pccb UTSW 9 100982797 missense probably damaging 1.00
R2128:Pccb UTSW 9 100985831 missense probably damaging 1.00
R2292:Pccb UTSW 9 100994632 missense probably benign
R3056:Pccb UTSW 9 101030197 missense probably damaging 1.00
R4574:Pccb UTSW 9 100985199 missense probably damaging 1.00
R4600:Pccb UTSW 9 101034779 missense probably benign
R5087:Pccb UTSW 9 100985243 intron probably benign
R5219:Pccb UTSW 9 100985209 nonsense probably null
R5586:Pccb UTSW 9 100985803 missense possibly damaging 0.87
R6813:Pccb UTSW 9 101023215 missense probably damaging 1.00
R6982:Pccb UTSW 9 101023296 splice site probably null
R7253:Pccb UTSW 9 101031913 missense probably benign 0.01
R7535:Pccb UTSW 9 100994562 splice site probably null
R7795:Pccb UTSW 9 100999263 missense probably damaging 1.00
R7822:Pccb UTSW 9 101027084 missense probably damaging 1.00
R8298:Pccb UTSW 9 100985832 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTCTCCCCTGGTTACGGAAGG -3'
(R):5'- GTCCTCTGTAGCAAGGGATG -3'

Sequencing Primer
(F):5'- CCTGGTTACGGAAGGGCAGAAG -3'
(R):5'- CTCTGTAGCAAGGGATGGCAGG -3'
Posted On2017-01-03