Incidental Mutation 'R5724:Ppp2r3c'
ID452397
Institutional Source Beutler Lab
Gene Symbol Ppp2r3c
Ensembl Gene ENSMUSG00000021022
Gene Nameprotein phosphatase 2, regulatory subunit B'', gamma
Synonyms4930511A21Rik, G5pr, G4-1, 5730412A08Rik
MMRRC Submission 043342-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5724 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location55278991-55302998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55297832 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 117 (M117K)
Ref Sequence ENSEMBL: ENSMUSP00000021410 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021410] [ENSMUST00000021411] [ENSMUST00000184980]
Predicted Effect probably benign
Transcript: ENSMUST00000021410
AA Change: M117K

PolyPhen 2 Score 0.448 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000021410
Gene: ENSMUSG00000021022
AA Change: M117K

DomainStartEndE-ValueType
PDB:4I5K|B 188 437 1e-25 PDB
SCOP:d1dgua_ 258 413 4e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021411
SMART Domains Protein: ENSMUSP00000021411
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
Pfam:PRORP 339 575 4.8e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184249
Predicted Effect probably benign
Transcript: ENSMUST00000184980
SMART Domains Protein: ENSMUSP00000139123
Gene: ENSMUSG00000021023

DomainStartEndE-ValueType
low complexity region 113 127 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219809
Meta Mutation Damage Score 0.6512 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory subunit of the serine/threonine phosphatase, protein phosphatase 2. This protein is localized to both nuclear and cytoplasmic regions depending on cell cycle phase. Homozygous conditional knockout mice for this gene exhibit reduced numbers and impaired proliferation of immune system B cells. This protein may regulate the expression of the P-glycoprotein ATP-binding cassette transporter through its phosphatase activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,032,397 noncoding transcript Het
Adam5 T A 8: 24,804,495 K363* probably null Het
Adamts12 T C 15: 11,286,750 Y814H probably benign Het
Adar G T 3: 89,735,169 G119V probably benign Het
Adprhl2 G T 4: 126,318,076 Q148K probably damaging Het
Atr G T 9: 95,866,588 L395F probably damaging Het
Bahcc1 A G 11: 120,285,366 I1946V possibly damaging Het
Bend4 T A 5: 67,417,941 D199V probably damaging Het
Bpifb1 C A 2: 154,204,792 H77Q probably benign Het
Clca1 T C 3: 145,009,072 T595A probably benign Het
Crebbp A T 16: 4,087,635 probably benign Het
Cxcl16 T C 11: 70,459,164 D12G probably damaging Het
Dnah10 T C 5: 124,742,026 W459R probably benign Het
Dock8 T C 19: 25,122,421 L636P probably damaging Het
Eif2ak3 A G 6: 70,876,840 T197A probably benign Het
Fbxo40 T A 16: 36,970,330 R139S probably benign Het
Fer C A 17: 63,924,157 T301K probably damaging Het
Fgf21 A T 7: 45,615,305 M1K probably null Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gm38706 A T 6: 130,483,000 noncoding transcript Het
H2-Q6 A C 17: 35,425,652 Y139S probably damaging Het
Igkv4-53 A T 6: 69,649,007 Y59N probably damaging Het
Jrkl T C 9: 13,244,886 M257V possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Klhl26 T A 8: 70,451,754 Y468F probably damaging Het
Lamb2 T A 9: 108,480,751 probably null Het
Lcp1 A G 14: 75,226,982 T548A probably benign Het
Lct T A 1: 128,300,336 Q1140L probably benign Het
Lrp2 T G 2: 69,451,382 N3882H probably damaging Het
Magi1 A G 6: 93,680,871 I1126T probably benign Het
Magi1 A G 6: 93,745,701 S399P probably damaging Het
Med16 A G 10: 79,895,409 C825R probably damaging Het
Mtx3 C T 13: 92,847,587 P124L probably damaging Het
Nabp2 C T 10: 128,409,686 probably benign Het
Olfr1467 T A 19: 13,365,151 H174Q possibly damaging Het
Pak4 A T 7: 28,564,580 S244T possibly damaging Het
Pccb C T 9: 100,987,847 V307I probably benign Het
Plekhh2 A G 17: 84,566,805 D506G probably benign Het
Plk4 T C 3: 40,801,046 V26A probably damaging Het
Pspc1 C T 14: 56,778,072 E30K probably benign Het
Reps1 A G 10: 18,114,483 S448G possibly damaging Het
Rnf34 C T 5: 122,866,889 Q241* probably null Het
Sgta A T 10: 81,047,688 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Siglech A G 7: 55,768,545 N87S probably damaging Het
Sptbn1 A G 11: 30,144,113 I392T possibly damaging Het
St18 T A 1: 6,770,950 M21K probably benign Het
Sugp1 C T 8: 70,070,149 R500C probably damaging Het
Tasp1 T C 2: 140,057,419 K5E probably damaging Het
Tbx3 G A 5: 119,675,603 V235I possibly damaging Het
Toporsl A T 4: 52,611,346 N413I probably damaging Het
Ttc30a2 T C 2: 75,977,730 D146G probably benign Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Zfp60 A G 7: 27,748,333 Y142C probably benign Het
Other mutations in Ppp2r3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Ppp2r3c APN 12 55292498 splice site probably null
IGL01122:Ppp2r3c APN 12 55297802 missense probably benign 0.20
IGL01954:Ppp2r3c APN 12 55292568 missense probably damaging 1.00
IGL02939:Ppp2r3c APN 12 55298407 unclassified probably benign
R0045:Ppp2r3c UTSW 12 55293821 missense probably damaging 0.99
R0129:Ppp2r3c UTSW 12 55298422 missense probably damaging 0.96
R2411:Ppp2r3c UTSW 12 55298484 missense probably benign 0.19
R4468:Ppp2r3c UTSW 12 55297883 nonsense probably null
R4746:Ppp2r3c UTSW 12 55302635 unclassified probably null
R5499:Ppp2r3c UTSW 12 55288626 missense probably benign 0.09
R6724:Ppp2r3c UTSW 12 55288496 missense probably benign 0.02
R6776:Ppp2r3c UTSW 12 55298467 nonsense probably null
R7706:Ppp2r3c UTSW 12 55281705 missense probably benign 0.23
R7975:Ppp2r3c UTSW 12 55287993 nonsense probably null
R8111:Ppp2r3c UTSW 12 55297849 missense probably benign
RF006:Ppp2r3c UTSW 12 55293815 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- TCCAACTTCCATCAATATTTGAGGC -3'
(R):5'- GCTTACACTAGATAGTTACATGGGC -3'

Sequencing Primer
(F):5'- GTGGCTCACAACCATCTGTAATTGG -3'
(R):5'- ACACTAGATAGTTACATGGGCTAAAG -3'
Posted On2017-01-03