Mutagenetix > Incidental Mutation

Incidental Mutation 'R0552:Adam9'

45240

Institutional Source

Beutler Lab

Gene Symbol

Adam9

Ensembl Gene

ENSMUSG00000031555

Gene Name

a disintegrin and metallopeptidase domain 9 (meltrin gamma)

Synonyms

MDC9, MDC9, Mltng, Mltng

MMRRC Submission

038744-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0552 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24949611-25016927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 24963010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 760 (N760K)

Ref Sequence

ENSEMBL: ENSMUSP00000081048 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084032] [ENSMUST00000084035] [ENSMUST00000208247]

AlphaFold

Q61072

Predicted Effect

probably benign
Transcript: ENSMUST00000084032
AA Change: N760K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081045
Gene: ENSMUSG00000031555
AA Change: N760K

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Pep_M12B_propep	43	163	8.5e-36	PFAM
Pfam:Reprolysin_5	210	386	5.5e-20	PFAM
Pfam:Reprolysin_4	210	402	1.4e-11	PFAM
Pfam:Reprolysin	212	406	1e-67	PFAM
Pfam:Reprolysin_2	232	396	1.1e-12	PFAM
Pfam:Reprolysin_3	236	358	8.1e-19	PFAM
DISIN	423	499	8.7e-44	SMART
ACR	500	637	9.7e-75	SMART
EGF	643	674	9.9e-2	SMART
transmembrane domain	699	718	N/A	INTRINSIC
low complexity region	753	787	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000084035
AA Change: N760K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000081048
Gene: ENSMUSG00000031555
AA Change: N760K

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Pep_M12B_propep	34	163	8.1e-31	PFAM
Pfam:Reprolysin_5	210	386	5.8e-22	PFAM
Pfam:Reprolysin_4	210	402	1.6e-13	PFAM
Pfam:Reprolysin	212	406	1.9e-73	PFAM
Pfam:Reprolysin_2	232	396	9.4e-15	PFAM
Pfam:Reprolysin_3	236	358	3.4e-19	PFAM
DISIN	423	499	1.71e-41	SMART
ACR	500	637	2.86e-72	SMART
EGF	643	674	2.03e1	SMART
transmembrane domain	699	718	N/A	INTRINSIC
low complexity region	753	794	N/A	INTRINSIC
low complexity region	808	826	N/A	INTRINSIC
low complexity region	831	839	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208247
AA Change: N760K

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous knockout mice exhibit progressive retinal degeneration, disorganized retinal layers and a degenerate retinal pigment epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akr1b10	A	G	6: 34,392,985	T216A	possibly damaging	Het
Arsj	A	G	3: 126,439,344	R580G	probably benign	Het
C9	A	T	15: 6,445,437	I26F	probably damaging	Het
Cacna2d1	A	G	5: 16,328,043	E578G	probably damaging	Het
Clca4b	C	T	3: 144,916,775	V510I	probably benign	Het
Dab2	C	T	15: 6,435,414	T561I	possibly damaging	Het
E430018J23Rik	A	T	7: 127,392,332	I161N	possibly damaging	Het
Gm4737	T	A	16: 46,154,592	T141S	probably benign	Het
Golga5	A	T	12: 102,484,493	E12D	possibly damaging	Het
Hsd17b12	A	T	2: 94,043,935	F208I	probably damaging	Het
Inf2	A	G	12: 112,612,574		probably benign	Het
Kcnh3	T	A	15: 99,229,456	W378R	probably damaging	Het
Klhdc8b	G	C	9: 108,449,223	R158G	possibly damaging	Het
Klhl41	G	A	2: 69,670,210	R5Q	probably benign	Het
Lcn3	T	C	2: 25,766,409		probably null	Het
Mppe1	A	G	18: 67,237,348		probably null	Het
Muc20	G	A	16: 32,793,930	A359V	probably damaging	Het
Myh14	T	C	7: 44,613,681	D1765G	probably damaging	Het
Olfr1257	C	T	2: 89,880,891	Q22*	probably null	Het
Olfr418	T	C	1: 173,270,805	M210T	probably benign	Het
Olfr482	A	G	7: 108,094,778	M264T	probably benign	Het
Pbrm1	T	A	14: 31,035,959	L182Q	probably damaging	Het
Pde8a	A	G	7: 81,317,347	N412S	probably benign	Het
Phyh	A	G	2: 4,936,101	T271A	probably damaging	Het
Pkhd1l1	T	C	15: 44,489,546	S258P	probably damaging	Het
Ptpro	T	A	6: 137,443,594	V1007D	probably damaging	Het
Pyroxd1	A	G	6: 142,345,737	E2G	probably benign	Het
Ralgapa1	G	T	12: 55,676,765	Q2115K	probably benign	Het
Rufy3	A	G	5: 88,584,270	E44G	possibly damaging	Het
Slit2	A	T	5: 48,238,379	N712I	probably damaging	Het
Sptbn1	A	G	11: 30,145,985	M303T	possibly damaging	Het
Ssbp4	A	G	8: 70,599,859	I154T	probably benign	Het
Syne2	A	G	12: 75,931,004	K1409E	probably benign	Het
Tfap2b	T	C	1: 19,234,225	Y420H	probably damaging	Het
Tlr5	A	G	1: 182,975,696		probably null	Het
Tmprss15	C	T	16: 79,024,749		probably null	Het
Tns1	A	T	1: 73,920,563	I418N	probably damaging	Het
Txlna	A	T	4: 129,629,191	V452D	probably benign	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Zfp563	A	T	17: 33,104,685	S85C	possibly damaging	Het

Other mutations in Adam9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01611:Adam9	APN	8	24967196	missense	probably benign	0.03
IGL01786:Adam9	APN	8	24996839	missense	probably damaging	1.00
IGL02095:Adam9	APN	8	24996729	missense	probably benign	0.00
IGL02322:Adam9	APN	8	24955974	missense	probably damaging	1.00
IGL02555:Adam9	APN	8	24966736	missense	probably damaging	1.00
IGL02869:Adam9	APN	8	24970618	missense	probably damaging	1.00
R0126:Adam9	UTSW	8	24970737	missense	probably damaging	1.00
R0448:Adam9	UTSW	8	24964910	missense	probably damaging	1.00
R0730:Adam9	UTSW	8	24996758	missense	probably benign	0.02
R1455:Adam9	UTSW	8	24993109	missense	probably benign	0.00
R1974:Adam9	UTSW	8	24992224	missense	probably damaging	1.00
R2043:Adam9	UTSW	8	24996653	critical splice donor site	probably null
R2054:Adam9	UTSW	8	24991294	missense	probably damaging	1.00
R2091:Adam9	UTSW	8	24995184	splice site	probably benign
R2111:Adam9	UTSW	8	24982126	splice site	probably benign
R4261:Adam9	UTSW	8	24964907	nonsense	probably null
R4852:Adam9	UTSW	8	25003301	missense	probably damaging	1.00
R5165:Adam9	UTSW	8	24967174	missense	possibly damaging	0.88
R6022:Adam9	UTSW	8	25003305	missense	possibly damaging	0.87
R6101:Adam9	UTSW	8	24970759	missense	probably damaging	1.00
R6105:Adam9	UTSW	8	24970759	missense	probably damaging	1.00
R6415:Adam9	UTSW	8	24978482	missense	probably damaging	1.00
R7241:Adam9	UTSW	8	24950986	missense	possibly damaging	0.53
R7442:Adam9	UTSW	8	24967207	missense	probably damaging	0.99
R7552:Adam9	UTSW	8	24955972	missense	unknown
R8076:Adam9	UTSW	8	24962922	nonsense	probably null
R8265:Adam9	UTSW	8	24967186	missense	probably damaging	1.00
R8762:Adam9	UTSW	8	24967219	missense	probably damaging	0.99
R9157:Adam9	UTSW	8	25003315	missense	probably damaging	0.98
R9164:Adam9	UTSW	8	24996779	missense	possibly damaging	0.79
R9424:Adam9	UTSW	8	24955937	missense	probably benign	0.06
R9576:Adam9	UTSW	8	24955937	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- CCAAGGGATGCCAGCTACTGAAAC -3'
(R):5'- CTCTGGTTGTCACTACCAGCATCAC -3'

Sequencing Primer
(F):5'- TTTTGGGGCTGAAGATCAAACC -3'
(R):5'- CAGCATCACCAACGTTTTATTTTG -3'

Posted On

2013-06-11