Incidental Mutation 'R0552:Adam9'
ID 45240
Institutional Source Beutler Lab
Gene Symbol Adam9
Ensembl Gene ENSMUSG00000031555
Gene Name a disintegrin and metallopeptidase domain 9 (meltrin gamma)
Synonyms MDC9, MDC9, Mltng, Mltng
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0552 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 24949611-25016927 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 24963010 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 760 (N760K)
Ref Sequence ENSEMBL: ENSMUSP00000081048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084032] [ENSMUST00000084035] [ENSMUST00000208247]
AlphaFold Q61072
Predicted Effect probably benign
Transcript: ENSMUST00000084032
AA Change: N760K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000081045
Gene: ENSMUSG00000031555
AA Change: N760K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 163 8.5e-36 PFAM
Pfam:Reprolysin_5 210 386 5.5e-20 PFAM
Pfam:Reprolysin_4 210 402 1.4e-11 PFAM
Pfam:Reprolysin 212 406 1e-67 PFAM
Pfam:Reprolysin_2 232 396 1.1e-12 PFAM
Pfam:Reprolysin_3 236 358 8.1e-19 PFAM
DISIN 423 499 8.7e-44 SMART
ACR 500 637 9.7e-75 SMART
EGF 643 674 9.9e-2 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 787 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084035
AA Change: N760K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000081048
Gene: ENSMUSG00000031555
AA Change: N760K

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 163 8.1e-31 PFAM
Pfam:Reprolysin_5 210 386 5.8e-22 PFAM
Pfam:Reprolysin_4 210 402 1.6e-13 PFAM
Pfam:Reprolysin 212 406 1.9e-73 PFAM
Pfam:Reprolysin_2 232 396 9.4e-15 PFAM
Pfam:Reprolysin_3 236 358 3.4e-19 PFAM
DISIN 423 499 1.71e-41 SMART
ACR 500 637 2.86e-72 SMART
EGF 643 674 2.03e1 SMART
transmembrane domain 699 718 N/A INTRINSIC
low complexity region 753 794 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 831 839 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000208247
AA Change: N760K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAM (a disintegrin and metalloprotease domain) family. Members of this family are membrane-anchored proteins structurally related to snake venom disintegrins, and have been implicated in a variety of biological processes involving cell-cell and cell-matrix interactions, including fertilization, muscle development, and neurogenesis. The protein encoded by this gene interacts with SH3 domain-containing proteins, binds mitotic arrest deficient 2 beta protein, and is also involved in TPA-induced ectodomain shedding of membrane-anchored heparin-binding EGF-like growth factor. Several alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous knockout mice exhibit progressive retinal degeneration, disorganized retinal layers and a degenerate retinal pigment epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Adam9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Adam9 APN 8 24967196 missense probably benign 0.03
IGL01786:Adam9 APN 8 24996839 missense probably damaging 1.00
IGL02095:Adam9 APN 8 24996729 missense probably benign 0.00
IGL02322:Adam9 APN 8 24955974 missense probably damaging 1.00
IGL02555:Adam9 APN 8 24966736 missense probably damaging 1.00
IGL02869:Adam9 APN 8 24970618 missense probably damaging 1.00
R0126:Adam9 UTSW 8 24970737 missense probably damaging 1.00
R0448:Adam9 UTSW 8 24964910 missense probably damaging 1.00
R0730:Adam9 UTSW 8 24996758 missense probably benign 0.02
R1455:Adam9 UTSW 8 24993109 missense probably benign 0.00
R1974:Adam9 UTSW 8 24992224 missense probably damaging 1.00
R2043:Adam9 UTSW 8 24996653 critical splice donor site probably null
R2054:Adam9 UTSW 8 24991294 missense probably damaging 1.00
R2091:Adam9 UTSW 8 24995184 splice site probably benign
R2111:Adam9 UTSW 8 24982126 splice site probably benign
R4261:Adam9 UTSW 8 24964907 nonsense probably null
R4852:Adam9 UTSW 8 25003301 missense probably damaging 1.00
R5165:Adam9 UTSW 8 24967174 missense possibly damaging 0.88
R6022:Adam9 UTSW 8 25003305 missense possibly damaging 0.87
R6101:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6105:Adam9 UTSW 8 24970759 missense probably damaging 1.00
R6415:Adam9 UTSW 8 24978482 missense probably damaging 1.00
R7241:Adam9 UTSW 8 24950986 missense possibly damaging 0.53
R7442:Adam9 UTSW 8 24967207 missense probably damaging 0.99
R7552:Adam9 UTSW 8 24955972 missense unknown
R8076:Adam9 UTSW 8 24962922 nonsense probably null
R8265:Adam9 UTSW 8 24967186 missense probably damaging 1.00
R8762:Adam9 UTSW 8 24967219 missense probably damaging 0.99
R9157:Adam9 UTSW 8 25003315 missense probably damaging 0.98
R9164:Adam9 UTSW 8 24996779 missense possibly damaging 0.79
R9424:Adam9 UTSW 8 24955937 missense probably benign 0.06
R9576:Adam9 UTSW 8 24955937 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCAAGGGATGCCAGCTACTGAAAC -3'
(R):5'- CTCTGGTTGTCACTACCAGCATCAC -3'

Sequencing Primer
(F):5'- TTTTGGGGCTGAAGATCAAACC -3'
(R):5'- CAGCATCACCAACGTTTTATTTTG -3'
Posted On 2013-06-11