Incidental Mutation 'R5724:Fer'
ID452407
Institutional Source Beutler Lab
Gene Symbol Fer
Ensembl Gene ENSMUSG00000000127
Gene Namefer (fms/fps related) protein kinase
SynonymsFert, Fert2
MMRRC Submission 043342-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5724 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location63896018-64139494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 63924157 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 301 (T301K)
Ref Sequence ENSEMBL: ENSMUSP00000000129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000129]
Predicted Effect probably damaging
Transcript: ENSMUST00000000129
AA Change: T301K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000129
Gene: ENSMUSG00000000127
AA Change: T301K

DomainStartEndE-ValueType
FCH 1 92 1.29e-27 SMART
coiled coil region 123 174 N/A INTRINSIC
low complexity region 283 294 N/A INTRINSIC
coiled coil region 308 381 N/A INTRINSIC
SH2 459 538 5.9e-30 SMART
TyrKc 564 815 6.69e-148 SMART
Meta Mutation Damage Score 0.172 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the FPS/FES family of non-transmembrane receptor tyrosine kinases. It regulates cell-cell adhesion and mediates signaling from the cell surface to the cytoskeleton via growth factor receptors. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome X. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a targeted mutation exhibit elevated lipopolysaccharide-induced leukocyte adhesion and migration. Mutant cells also exhibit reduced phosphorylation of cortactin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830408C21Rik A T 13: 107,032,397 noncoding transcript Het
Adam5 T A 8: 24,804,495 K363* probably null Het
Adamts12 T C 15: 11,286,750 Y814H probably benign Het
Adar G T 3: 89,735,169 G119V probably benign Het
Adprhl2 G T 4: 126,318,076 Q148K probably damaging Het
Atr G T 9: 95,866,588 L395F probably damaging Het
Bahcc1 A G 11: 120,285,366 I1946V possibly damaging Het
Bend4 T A 5: 67,417,941 D199V probably damaging Het
Bpifb1 C A 2: 154,204,792 H77Q probably benign Het
Clca1 T C 3: 145,009,072 T595A probably benign Het
Crebbp A T 16: 4,087,635 probably benign Het
Cxcl16 T C 11: 70,459,164 D12G probably damaging Het
Dnah10 T C 5: 124,742,026 W459R probably benign Het
Dock8 T C 19: 25,122,421 L636P probably damaging Het
Eif2ak3 A G 6: 70,876,840 T197A probably benign Het
Fbxo40 T A 16: 36,970,330 R139S probably benign Het
Fgf21 A T 7: 45,615,305 M1K probably null Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm13083 A G 4: 143,617,456 D442G probably benign Het
Gm38706 A T 6: 130,483,000 noncoding transcript Het
H2-Q6 A C 17: 35,425,652 Y139S probably damaging Het
Igkv4-53 A T 6: 69,649,007 Y59N probably damaging Het
Jrkl T C 9: 13,244,886 M257V possibly damaging Het
Kat8 G A 7: 127,924,816 E343K probably damaging Het
Klhl26 T A 8: 70,451,754 Y468F probably damaging Het
Lamb2 T A 9: 108,480,751 probably null Het
Lcp1 A G 14: 75,226,982 T548A probably benign Het
Lct T A 1: 128,300,336 Q1140L probably benign Het
Lrp2 T G 2: 69,451,382 N3882H probably damaging Het
Magi1 A G 6: 93,680,871 I1126T probably benign Het
Magi1 A G 6: 93,745,701 S399P probably damaging Het
Med16 A G 10: 79,895,409 C825R probably damaging Het
Mtx3 C T 13: 92,847,587 P124L probably damaging Het
Nabp2 C T 10: 128,409,686 probably benign Het
Olfr1467 T A 19: 13,365,151 H174Q possibly damaging Het
Pak4 A T 7: 28,564,580 S244T possibly damaging Het
Pccb C T 9: 100,987,847 V307I probably benign Het
Plekhh2 A G 17: 84,566,805 D506G probably benign Het
Plk4 T C 3: 40,801,046 V26A probably damaging Het
Ppp2r3c A T 12: 55,297,832 M117K probably benign Het
Pspc1 C T 14: 56,778,072 E30K probably benign Het
Reps1 A G 10: 18,114,483 S448G possibly damaging Het
Rnf34 C T 5: 122,866,889 Q241* probably null Het
Sgta A T 10: 81,047,688 probably null Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Siglech A G 7: 55,768,545 N87S probably damaging Het
Sptbn1 A G 11: 30,144,113 I392T possibly damaging Het
St18 T A 1: 6,770,950 M21K probably benign Het
Sugp1 C T 8: 70,070,149 R500C probably damaging Het
Tasp1 T C 2: 140,057,419 K5E probably damaging Het
Tbx3 G A 5: 119,675,603 V235I possibly damaging Het
Toporsl A T 4: 52,611,346 N413I probably damaging Het
Ttc30a2 T C 2: 75,977,730 D146G probably benign Het
Ubqln3 G A 7: 104,141,467 P472L probably benign Het
Zfp60 A G 7: 27,748,333 Y142C probably benign Het
Other mutations in Fer
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01625:Fer APN 17 64037626 missense probably damaging 1.00
IGL02004:Fer APN 17 63924179 critical splice donor site probably null
IGL02103:Fer APN 17 64138928 missense probably benign 0.02
IGL02157:Fer APN 17 64138899 missense probably benign 0.03
IGL02217:Fer APN 17 64138965 missense probably benign 0.00
IGL02376:Fer APN 17 63934346 missense possibly damaging 0.69
IGL02955:Fer APN 17 63991717 critical splice donor site probably null
IGL02967:Fer APN 17 63896267 missense possibly damaging 0.69
IGL03392:Fer APN 17 63991642 missense probably damaging 0.97
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0095:Fer UTSW 17 63941326 missense possibly damaging 0.51
R0207:Fer UTSW 17 63896278 missense probably damaging 1.00
R0243:Fer UTSW 17 64078946 missense probably benign 0.00
R0309:Fer UTSW 17 64139016 makesense probably null
R0384:Fer UTSW 17 63924184 splice site probably benign
R0634:Fer UTSW 17 64035508 missense probably benign 0.40
R1885:Fer UTSW 17 64138914 missense probably damaging 0.96
R1939:Fer UTSW 17 63973128 missense probably damaging 1.00
R2427:Fer UTSW 17 63957303 missense probably benign
R2504:Fer UTSW 17 63991580 splice site probably null
R4301:Fer UTSW 17 64078910 missense probably damaging 1.00
R4404:Fer UTSW 17 63941289 critical splice acceptor site probably null
R4418:Fer UTSW 17 64029291 missense possibly damaging 0.89
R4812:Fer UTSW 17 63934297 missense probably benign
R5561:Fer UTSW 17 64037585 nonsense probably null
R5936:Fer UTSW 17 63924063 missense probably benign
R6157:Fer UTSW 17 64078885 missense probably damaging 1.00
R6848:Fer UTSW 17 63991606 missense probably damaging 1.00
R7175:Fer UTSW 17 63924095 missense probably benign 0.01
R7198:Fer UTSW 17 63921688 missense possibly damaging 0.84
R7438:Fer UTSW 17 64133521 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- CCTTTGGTATGCACTGCGA -3'
(R):5'- CAAAATGACTCTGCCACTAAGTACT -3'

Sequencing Primer
(F):5'- TGCACTGCGATAGATTATGCTAG -3'
(R):5'- CTATGTTCCCAGCACTGAGAGTAG -3'
Posted On2017-01-03