Incidental Mutation 'R0552:Wdr17'
ID 45241
Institutional Source Beutler Lab
Gene Symbol Wdr17
Ensembl Gene ENSMUSG00000039375
Gene Name WD repeat domain 17
Synonyms B230207L18Rik, 3010002I12Rik
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0552 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 54629055-54887184 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 54693096 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 90 (A90T)
Ref Sequence ENSEMBL: ENSMUSP00000135805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127511] [ENSMUST00000129132] [ENSMUST00000144482] [ENSMUST00000144711] [ENSMUST00000148408] [ENSMUST00000150488] [ENSMUST00000175915] [ENSMUST00000176866]
AlphaFold E9Q271
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126316
Predicted Effect probably benign
Transcript: ENSMUST00000127511
AA Change: A114T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000115550
Gene: ENSMUSG00000039375
AA Change: A114T

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 162 202 1.58e2 SMART
WD40 205 252 4.26e1 SMART
WD40 255 298 1.15e0 SMART
WD40 383 422 1.59e-7 SMART
WD40 425 465 2.39e0 SMART
WD40 468 509 5.52e-2 SMART
WD40 511 550 4.14e-6 SMART
WD40 555 595 5.14e-11 SMART
WD40 598 638 6.58e-9 SMART
WD40 641 681 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129132
AA Change: A90T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134935
Gene: ENSMUSG00000039375
AA Change: A90T

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
Blast:WD40 91 131 1e-12 BLAST
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 271 9.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144482
SMART Domains Protein: ENSMUSP00000134950
Gene: ENSMUSG00000039375

DomainStartEndE-ValueType
Blast:WD40 16 65 2e-24 BLAST
WD40 70 109 1.59e-7 SMART
WD40 112 152 2.39e0 SMART
WD40 155 196 5.52e-2 SMART
WD40 198 237 4.14e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144711
AA Change: A114T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117710
Gene: ENSMUSG00000039375
AA Change: A114T

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 194 235 7.64e1 SMART
WD40 238 281 1.15e0 SMART
WD40 366 405 1.59e-7 SMART
WD40 408 448 2.39e0 SMART
WD40 451 492 5.52e-2 SMART
WD40 494 533 4.14e-6 SMART
WD40 538 578 5.14e-11 SMART
WD40 581 621 6.58e-9 SMART
WD40 624 664 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148806
Predicted Effect possibly damaging
Transcript: ENSMUST00000150488
AA Change: A90T

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122326
Gene: ENSMUSG00000039375
AA Change: A90T

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000175915
AA Change: A90T

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135805
Gene: ENSMUSG00000039375
AA Change: A90T

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176866
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein. It is abundantly expressed in retina and testis, and is thought to be a candidate gene for retinal disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Wdr17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Wdr17 APN 8 54687711 missense probably damaging 1.00
IGL00496:Wdr17 APN 8 54659579 splice site probably benign
IGL01318:Wdr17 APN 8 54672550 missense probably damaging 1.00
IGL01347:Wdr17 APN 8 54651345 missense probably benign
IGL01654:Wdr17 APN 8 54662879 missense probably damaging 1.00
IGL02010:Wdr17 APN 8 54659703 missense probably damaging 0.97
IGL02085:Wdr17 APN 8 54687736 nonsense probably null
IGL02205:Wdr17 APN 8 54696300 missense probably damaging 1.00
IGL02375:Wdr17 APN 8 54696388 missense possibly damaging 0.94
IGL02705:Wdr17 APN 8 54648215 splice site probably null
IGL02719:Wdr17 APN 8 54693054 splice site probably null
IGL03051:Wdr17 APN 8 54651314 missense probably damaging 0.99
IGL03131:Wdr17 APN 8 54696267 critical splice donor site probably null
IGL03172:Wdr17 APN 8 54661480 missense probably damaging 0.96
enthralled UTSW 8 54659681 missense possibly damaging 0.85
riveted UTSW 8 54632487 missense probably benign 0.00
thrilled UTSW 8 54696268 critical splice donor site probably null
IGL03138:Wdr17 UTSW 8 54649143 missense probably damaging 1.00
PIT4458001:Wdr17 UTSW 8 54673579 nonsense probably null
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0124:Wdr17 UTSW 8 54635491 missense probably damaging 1.00
R0226:Wdr17 UTSW 8 54663008 missense probably benign 0.08
R0270:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0271:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0288:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0321:Wdr17 UTSW 8 54696268 critical splice donor site probably null
R0464:Wdr17 UTSW 8 54670392 splice site probably benign
R0479:Wdr17 UTSW 8 54651421 splice site probably null
R0488:Wdr17 UTSW 8 54693052 unclassified probably benign
R0553:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0600:Wdr17 UTSW 8 54661495 missense probably damaging 1.00
R0621:Wdr17 UTSW 8 54643191 missense probably benign 0.18
R0655:Wdr17 UTSW 8 54649198 missense probably damaging 1.00
R0730:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0789:Wdr17 UTSW 8 54659572 splice site probably benign
R0854:Wdr17 UTSW 8 54703881 missense probably benign
R0879:Wdr17 UTSW 8 54661481 missense probably benign 0.08
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1497:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R1589:Wdr17 UTSW 8 54703907 intron probably benign
R1618:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R1768:Wdr17 UTSW 8 54673654 missense possibly damaging 0.84
R1778:Wdr17 UTSW 8 54690214 missense probably damaging 1.00
R1819:Wdr17 UTSW 8 54690124 missense probably benign 0.18
R1913:Wdr17 UTSW 8 54687726 missense probably damaging 1.00
R2129:Wdr17 UTSW 8 54632381 missense probably damaging 1.00
R2132:Wdr17 UTSW 8 54672506 missense probably damaging 1.00
R2309:Wdr17 UTSW 8 54643248 missense probably benign
R3882:Wdr17 UTSW 8 54639501 missense possibly damaging 0.53
R4097:Wdr17 UTSW 8 54635469 missense probably damaging 1.00
R4372:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R4380:Wdr17 UTSW 8 54648407 intron probably benign
R4480:Wdr17 UTSW 8 54664964 critical splice donor site probably null
R4654:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4656:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4669:Wdr17 UTSW 8 54690048 missense possibly damaging 0.72
R4719:Wdr17 UTSW 8 54639876 missense probably benign 0.33
R4912:Wdr17 UTSW 8 54629861 missense probably damaging 1.00
R5000:Wdr17 UTSW 8 54665126 missense possibly damaging 0.82
R5073:Wdr17 UTSW 8 54690236 critical splice acceptor site probably null
R5176:Wdr17 UTSW 8 54653878 critical splice donor site probably null
R5194:Wdr17 UTSW 8 54687604 missense probably damaging 1.00
R5270:Wdr17 UTSW 8 54643186 missense probably benign 0.20
R5300:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5325:Wdr17 UTSW 8 54659681 missense possibly damaging 0.85
R5336:Wdr17 UTSW 8 54632318 missense probably damaging 1.00
R5394:Wdr17 UTSW 8 54639489 missense possibly damaging 0.73
R5424:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5425:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5426:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5548:Wdr17 UTSW 8 54703851 missense probably damaging 0.97
R5681:Wdr17 UTSW 8 54662869 missense probably damaging 1.00
R5722:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R5894:Wdr17 UTSW 8 54696300 missense probably damaging 1.00
R5906:Wdr17 UTSW 8 54639468 missense probably benign 0.33
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6391:Wdr17 UTSW 8 54661460 missense probably benign 0.04
R6605:Wdr17 UTSW 8 54681524 missense probably benign 0.16
R6892:Wdr17 UTSW 8 54673596 missense probably damaging 1.00
R7019:Wdr17 UTSW 8 54681453 missense probably damaging 1.00
R7257:Wdr17 UTSW 8 54632487 missense probably benign 0.00
R7481:Wdr17 UTSW 8 54661336 missense probably benign
R7868:Wdr17 UTSW 8 54696267 critical splice donor site probably null
R7939:Wdr17 UTSW 8 54687642 missense probably damaging 0.98
R7962:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R8017:Wdr17 UTSW 8 54638368 missense possibly damaging 0.73
R8122:Wdr17 UTSW 8 54664976 missense probably damaging 1.00
R8226:Wdr17 UTSW 8 54693120 missense possibly damaging 0.52
R8251:Wdr17 UTSW 8 54657232 missense probably damaging 1.00
R8413:Wdr17 UTSW 8 54662918 missense probably benign 0.08
R8534:Wdr17 UTSW 8 54648230 missense probably benign 0.08
R8708:Wdr17 UTSW 8 54640092 intron probably benign
R9116:Wdr17 UTSW 8 54661570 missense probably damaging 1.00
R9258:Wdr17 UTSW 8 54659619 nonsense probably null
R9351:Wdr17 UTSW 8 54690022 missense probably benign 0.00
R9475:Wdr17 UTSW 8 54635477 missense probably benign 0.00
R9546:Wdr17 UTSW 8 54659700 missense probably damaging 1.00
R9547:Wdr17 UTSW 8 54659700 missense probably damaging 1.00
V5088:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
X0022:Wdr17 UTSW 8 54639494 missense probably benign 0.04
X0066:Wdr17 UTSW 8 54673560 missense probably damaging 1.00
Z1177:Wdr17 UTSW 8 54643185 missense probably benign 0.03
Z1177:Wdr17 UTSW 8 54670379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTAATAgtaatggcatacctttaatcccag -3'
(R):5'- GGTTGAATGAAAACCAAGGCATAACATGA -3'

Sequencing Primer
(F):5'- agaacacataaatgaacaggcaag -3'
(R):5'- GGTTGCTAACTGAGAGCATATTACG -3'
Posted On 2013-06-11