Incidental Mutation 'R5725:Topors'
ID452426
Institutional Source Beutler Lab
Gene Symbol Topors
Ensembl Gene ENSMUSG00000036822
Gene Nametopoisomerase I binding, arginine/serine-rich
Synonyms
MMRRC Submission 043343-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.543) question?
Stock #R5725 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location40259601-40269850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40261952 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 444 (D444G)
Ref Sequence ENSEMBL: ENSMUSP00000046843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042575]
Predicted Effect probably damaging
Transcript: ENSMUST00000042575
AA Change: D444G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046843
Gene: ENSMUSG00000036822
AA Change: D444G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 29 44 N/A INTRINSIC
RING 104 142 7.27e-7 SMART
low complexity region 196 209 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 465 478 N/A INTRINSIC
low complexity region 494 505 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 589 610 N/A INTRINSIC
low complexity region 620 696 N/A INTRINSIC
low complexity region 756 780 N/A INTRINSIC
low complexity region 837 860 N/A INTRINSIC
low complexity region 877 894 N/A INTRINSIC
Meta Mutation Damage Score 0.0626 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein which is serine and arginine rich, and contains a RING-type zinc finger domain. It is highly expressed in the testis, and functions as an ubiquitin-protein E3 ligase. Mutations in this gene are associated with retinitis pigmentosa type 31. Alternatively spliced transcript variants, encoding different isoforms, have been observed for this locus. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Agrn T A 4: 156,173,875 T938S probably benign Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Aplp2 T C 9: 31,157,814 D573G probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itgax A G 7: 128,147,861 T945A possibly damaging Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa T A 4: 65,189,410 V686E probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sept14 T C 5: 129,689,566 D317G probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Smg6 A G 11: 74,930,613 Q570R probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Topors
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Topors APN 4 40262417 missense probably damaging 1.00
IGL01541:Topors APN 4 40262364 missense possibly damaging 0.70
IGL02093:Topors APN 4 40261467 missense probably damaging 0.98
R0039:Topors UTSW 4 40262772 missense probably damaging 1.00
R0483:Topors UTSW 4 40261952 missense probably damaging 0.96
R0645:Topors UTSW 4 40260333 missense unknown
R1413:Topors UTSW 4 40261982 missense probably benign 0.01
R1507:Topors UTSW 4 40261829 missense probably damaging 0.99
R1677:Topors UTSW 4 40261776 missense probably damaging 0.99
R1863:Topors UTSW 4 40262149 nonsense probably null
R1960:Topors UTSW 4 40261044 missense unknown
R2035:Topors UTSW 4 40262879 missense probably damaging 1.00
R2155:Topors UTSW 4 40262790 missense possibly damaging 0.72
R2519:Topors UTSW 4 40261714 nonsense probably null
R3035:Topors UTSW 4 40269673 critical splice donor site probably null
R3037:Topors UTSW 4 40269673 critical splice donor site probably null
R3842:Topors UTSW 4 40262123 missense probably benign 0.01
R4090:Topors UTSW 4 40260794 missense unknown
R4668:Topors UTSW 4 40262669 missense probably damaging 0.98
R4686:Topors UTSW 4 40261694 missense probably benign 0.03
R4694:Topors UTSW 4 40261442 missense possibly damaging 0.94
R4749:Topors UTSW 4 40261015 missense unknown
R5228:Topors UTSW 4 40262367 missense probably damaging 1.00
R5304:Topors UTSW 4 40262541 missense possibly damaging 0.50
R6617:Topors UTSW 4 40261896 nonsense probably null
R6699:Topors UTSW 4 40262300 missense probably damaging 0.97
R6869:Topors UTSW 4 40261201 missense unknown
R7103:Topors UTSW 4 40261706 missense probably benign 0.03
R7319:Topors UTSW 4 40260540 missense unknown
R7543:Topors UTSW 4 40268312 missense probably damaging 0.99
R7545:Topors UTSW 4 40262173 missense possibly damaging 0.91
R7559:Topors UTSW 4 40261401 missense unknown
R7748:Topors UTSW 4 40262654 missense probably damaging 1.00
R7899:Topors UTSW 4 40260356 missense unknown
R8045:Topors UTSW 4 40261988 missense probably benign 0.17
R8056:Topors UTSW 4 40262221 missense probably benign 0.30
R8221:Topors UTSW 4 40260686 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGAAGACAGTTCAACAAGTTCCG -3'
(R):5'- GGCAGCTTTTGACCAGCATG -3'

Sequencing Primer
(F):5'- AACAAGTTCCGGGGTCCTTTCAG -3'
(R):5'- GAAGGCAGCCGTTCAGATTCTTC -3'
Posted On2017-01-03