Incidental Mutation 'R5725:Pappa'
ID452427
Institutional Source Beutler Lab
Gene Symbol Pappa
Ensembl Gene ENSMUSG00000028370
Gene Namepregnancy-associated plasma protein A
SynonymsIGFBP-4ase, PAPP-A, PAG1, 8430414N03Rik
MMRRC Submission 043343-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.633) question?
Stock #R5725 (G1)
Quality Score214
Status Not validated
Chromosome4
Chromosomal Location65124174-65357509 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65189410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 686 (V686E)
Ref Sequence ENSEMBL: ENSMUSP00000081545 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084501]
Predicted Effect probably damaging
Transcript: ENSMUST00000084501
AA Change: V686E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000081545
Gene: ENSMUSG00000028370
AA Change: V686E

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 24 66 N/A INTRINSIC
low complexity region 69 87 N/A INTRINSIC
LamGL 114 263 1.55e-54 SMART
NL 396 438 4.15e-8 SMART
NL 441 471 6.73e-1 SMART
Pfam:Peptidase_M43 500 657 2.5e-10 PFAM
Blast:FN3 669 929 1e-165 BLAST
CCP 1212 1277 1.39e-9 SMART
CCP 1282 1339 1.08e-6 SMART
CCP 1343 1407 1.64e-6 SMART
CCP 1412 1468 8.06e-6 SMART
NL 1544 1581 3.24e-10 SMART
low complexity region 1584 1591 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted metalloproteinase which cleaves insulin-like growth factor binding proteins (IGFBPs). It is thought to be involved in local proliferative processes such as wound healing and bone remodeling. Low plasma level of this protein has been suggested as a biochemical marker for pregnancies with aneuploid fetuses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are smaller than normal with delayed ossification, but are otherwise normal and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Agrn T A 4: 156,173,875 T938S probably benign Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Aplp2 T C 9: 31,157,814 D573G probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itgax A G 7: 128,147,861 T945A possibly damaging Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sept14 T C 5: 129,689,566 D317G probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Smg6 A G 11: 74,930,613 Q570R probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Pappa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Pappa APN 4 65189316 missense probably damaging 1.00
IGL01340:Pappa APN 4 65323872 missense possibly damaging 0.49
IGL01482:Pappa APN 4 65156034 missense probably benign 0.18
IGL01485:Pappa APN 4 65189299 missense probably damaging 0.96
IGL01759:Pappa APN 4 65205158 splice site probably null
IGL01860:Pappa APN 4 65205092 missense possibly damaging 0.50
IGL01990:Pappa APN 4 65156687 splice site probably benign
IGL02089:Pappa APN 4 65156124 missense possibly damaging 0.75
IGL02153:Pappa APN 4 65297437 missense probably damaging 0.96
IGL02184:Pappa APN 4 65340691 missense possibly damaging 0.82
IGL02324:Pappa APN 4 65196808 missense probably damaging 0.99
IGL02542:Pappa APN 4 65176281 missense probably damaging 1.00
IGL02556:Pappa APN 4 65156626 missense possibly damaging 0.56
IGL02698:Pappa APN 4 65181020 missense probably damaging 1.00
IGL02903:Pappa APN 4 65261980 missense probably damaging 1.00
IGL02974:Pappa APN 4 65204935 missense probably damaging 1.00
IGL03107:Pappa APN 4 65204703 missense probably damaging 1.00
IGL03376:Pappa APN 4 65196834 missense probably benign 0.01
caer UTSW 4 65124891 missense probably damaging 0.98
Maennel UTSW 4 65314587 missense probably benign 0.05
maennelein UTSW 4 65314796 splice site probably null
mama UTSW 4 65204867 missense possibly damaging 0.94
untersuchen UTSW 4 65297257 missense probably damaging 1.00
IGL02980:Pappa UTSW 4 65307774 missense probably benign 0.25
PIT4498001:Pappa UTSW 4 65316232 missense probably damaging 1.00
R0077:Pappa UTSW 4 65307812 missense probably damaging 1.00
R0390:Pappa UTSW 4 65351613 splice site probably null
R0458:Pappa UTSW 4 65155882 missense probably damaging 1.00
R0883:Pappa UTSW 4 65189315 nonsense probably null
R0946:Pappa UTSW 4 65314792 critical splice donor site probably null
R1228:Pappa UTSW 4 65340689 missense probably damaging 1.00
R1327:Pappa UTSW 4 65351603 splice site probably benign
R1489:Pappa UTSW 4 65180948 missense possibly damaging 0.85
R1619:Pappa UTSW 4 65176229 missense probably damaging 1.00
R1856:Pappa UTSW 4 65340743 missense probably damaging 1.00
R2047:Pappa UTSW 4 65231141 splice site probably benign
R2102:Pappa UTSW 4 65316228 nonsense probably null
R2127:Pappa UTSW 4 65297257 missense probably damaging 1.00
R2143:Pappa UTSW 4 65180949 nonsense probably null
R2144:Pappa UTSW 4 65180949 nonsense probably null
R2166:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2167:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2168:Pappa UTSW 4 65156445 missense probably damaging 1.00
R2178:Pappa UTSW 4 65351687 missense probably benign 0.00
R2504:Pappa UTSW 4 65180889 nonsense probably null
R4043:Pappa UTSW 4 65314587 missense probably benign 0.05
R4289:Pappa UTSW 4 65155863 missense probably benign 0.19
R4415:Pappa UTSW 4 65305295 missense probably benign 0.00
R4529:Pappa UTSW 4 65231182 missense probably benign
R4620:Pappa UTSW 4 65327028 missense probably benign 0.43
R4657:Pappa UTSW 4 65314796 splice site probably null
R4658:Pappa UTSW 4 65314796 splice site probably null
R5074:Pappa UTSW 4 65205128 missense probably benign 0.15
R5200:Pappa UTSW 4 65155839 missense probably damaging 1.00
R5420:Pappa UTSW 4 65335780 critical splice donor site probably null
R5469:Pappa UTSW 4 65205152 missense probably benign 0.01
R5651:Pappa UTSW 4 65156352 missense probably damaging 0.99
R5941:Pappa UTSW 4 65314593 missense possibly damaging 0.52
R6002:Pappa UTSW 4 65297408 missense probably damaging 0.99
R6252:Pappa UTSW 4 65189412 missense probably benign 0.02
R6303:Pappa UTSW 4 65204654 missense probably damaging 1.00
R6322:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6431:Pappa UTSW 4 65156464 missense probably damaging 1.00
R6462:Pappa UTSW 4 65124891 missense probably damaging 0.98
R6484:Pappa UTSW 4 65314659 missense probably damaging 1.00
R6537:Pappa UTSW 4 65297282 missense probably damaging 0.99
R6578:Pappa UTSW 4 65156137 missense possibly damaging 0.48
R6704:Pappa UTSW 4 65204924 missense probably damaging 1.00
R6789:Pappa UTSW 4 65181041 missense probably damaging 1.00
R7023:Pappa UTSW 4 65351718 missense probably benign 0.00
R7139:Pappa UTSW 4 65189450 missense probably benign 0.30
R7158:Pappa UTSW 4 65204867 missense possibly damaging 0.94
R7165:Pappa UTSW 4 65261873 missense probably damaging 1.00
R7196:Pappa UTSW 4 65323891 splice site probably null
R7410:Pappa UTSW 4 65335719 missense probably damaging 1.00
R7457:Pappa UTSW 4 65189266 missense probably damaging 1.00
R7506:Pappa UTSW 4 65231182 missense probably benign 0.00
R7546:Pappa UTSW 4 65156115 missense possibly damaging 0.48
X0058:Pappa UTSW 4 65156232 missense probably damaging 1.00
X0060:Pappa UTSW 4 65124941 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGAGACGTCATTCTTCTCTTGC -3'
(R):5'- CACTGCTGAGTAGTGGGTTC -3'

Sequencing Primer
(F):5'- TGCCTGTGCAGCTTGGG -3'
(R):5'- GAGTAGTGGGTTCTTTATTCAACAAG -3'
Posted On2017-01-03