Incidental Mutation 'R5725:Agrn'
ID452431
Institutional Source Beutler Lab
Gene Symbol Agrn
Ensembl Gene ENSMUSG00000041936
Gene Nameagrin
SynonymsNMF380, Agrin, nmf380
MMRRC Submission 043343-MU
Accession Numbers

Genbank: NM_021604; MGI: 87961

Is this an essential gene? Possibly essential (E-score: 0.548) question?
Stock #R5725 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location156165290-156197488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156173875 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 938 (T938S)
Ref Sequence ENSEMBL: ENSMUSP00000101200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071248] [ENSMUST00000105574] [ENSMUST00000105575] [ENSMUST00000180572]
PDB Structure
Crystal structure of the G2 domain of Agrin from Mus Musculus [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000071248
AA Change: T938S

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071229
Gene: ENSMUSG00000041936
AA Change: T938S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1139 5.57e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105574
AA Change: T938S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101199
Gene: ENSMUSG00000041936
AA Change: T938S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1678 6.51e-36 SMART
EGF 1699 1735 4.35e-6 SMART
LamG 1771 1907 5.01e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105575
AA Change: T938S

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101200
Gene: ENSMUSG00000041936
AA Change: T938S

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
FOLN 66 91 8.25e-6 SMART
KAZAL 91 137 1.22e-17 SMART
FOLN 142 166 7.58e-5 SMART
EGF_like 142 181 7.38e1 SMART
KAZAL 166 212 1.51e-13 SMART
KAZAL 241 284 1.8e-6 SMART
KAZAL 310 356 1.55e-10 SMART
FOLN 362 384 8.25e-6 SMART
KAZAL 384 429 1.14e-17 SMART
KAZAL 449 494 6.43e-17 SMART
FOLN 496 519 2.94e-2 SMART
KAZAL 507 559 8.96e-16 SMART
low complexity region 565 572 N/A INTRINSIC
KAZAL 599 645 1.12e-16 SMART
EGF_Lam 688 739 3.29e-15 SMART
EGF_Lam 742 786 6.7e-7 SMART
FOLN 795 817 1.94e-2 SMART
KAZAL 817 864 3.9e-16 SMART
low complexity region 889 906 N/A INTRINSIC
low complexity region 949 978 N/A INTRINSIC
SEA 1014 1136 2.26e-35 SMART
low complexity region 1142 1169 N/A INTRINSIC
low complexity region 1183 1198 N/A INTRINSIC
EGF 1214 1249 1.49e-4 SMART
LamG 1274 1410 4e-45 SMART
EGF 1434 1468 2.23e-3 SMART
EGF 1473 1507 7.13e-2 SMART
LamG 1542 1682 9.2e-36 SMART
EGF 1703 1739 4.35e-6 SMART
LamG 1794 1930 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144749
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154494
Predicted Effect probably benign
Transcript: ENSMUST00000180572
AA Change: T1045S

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137931
Gene: ENSMUSG00000041936
AA Change: T1045S

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:NtA 32 159 5.1e-91 PFAM
FOLN 173 198 8.25e-6 SMART
KAZAL 198 244 1.22e-17 SMART
FOLN 249 273 7.58e-5 SMART
EGF_like 249 288 7.38e1 SMART
KAZAL 273 319 1.51e-13 SMART
KAZAL 348 391 1.8e-6 SMART
KAZAL 417 463 1.55e-10 SMART
FOLN 469 491 8.25e-6 SMART
KAZAL 491 536 1.14e-17 SMART
KAZAL 556 601 6.43e-17 SMART
FOLN 603 626 2.94e-2 SMART
KAZAL 614 666 8.96e-16 SMART
low complexity region 672 679 N/A INTRINSIC
KAZAL 706 752 1.12e-16 SMART
EGF_Lam 795 846 3.29e-15 SMART
EGF_Lam 849 893 6.7e-7 SMART
FOLN 902 924 1.94e-2 SMART
KAZAL 924 971 3.9e-16 SMART
low complexity region 996 1013 N/A INTRINSIC
low complexity region 1056 1085 N/A INTRINSIC
SEA 1121 1243 2.26e-35 SMART
low complexity region 1249 1276 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
EGF 1321 1356 1.49e-4 SMART
LamG 1381 1517 4e-45 SMART
EGF 1541 1575 2.23e-3 SMART
EGF 1580 1614 7.13e-2 SMART
LamG 1649 1785 6.51e-36 SMART
EGF 1806 1842 4.35e-6 SMART
LamG 1878 2014 5.01e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181062
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several proteins that are critical in the development of the neuromuscular junction (NMJ), as identified in mouse knock-out studies. The encoded protein contains several laminin G, Kazal type serine protease inhibitor, and epidermal growth factor domains. Additional post-translational modifications occur to add glycosaminoglycans and disulfide bonds. In one family with congenital myasthenic syndrome affecting limb-girdle muscles, a mutation in this gene was found. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Nullizygous mice display embryonic failure of NMJ formation, inability to breathe or move and perinatal lethality. Homozygotes for an ENU-induced allele show poor hindlimb motor control, myopathy, muscle atrophy, spasms and fiber-type switching, NMJ disaggregation, camptodactyly and premature death. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(4) Targeted, other(1) Gene trapped(7)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Aplp2 T C 9: 31,157,814 D573G probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itgax A G 7: 128,147,861 T945A possibly damaging Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa T A 4: 65,189,410 V686E probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sept14 T C 5: 129,689,566 D317G probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Smg6 A G 11: 74,930,613 Q570R probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Agrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Agrn APN 4 156170572 splice site probably benign
IGL00811:Agrn APN 4 156168774 missense possibly damaging 0.70
IGL01066:Agrn APN 4 156177343 missense probably benign 0.00
IGL01412:Agrn APN 4 156171034 splice site probably benign
IGL01414:Agrn APN 4 156195239 splice site probably null
IGL02075:Agrn APN 4 156170210 missense probably benign 0.40
IGL02609:Agrn APN 4 156175223 splice site probably benign
IGL02669:Agrn APN 4 156174561 splice site probably benign
IGL02671:Agrn APN 4 156174561 splice site probably benign
IGL02672:Agrn APN 4 156174561 splice site probably benign
IGL02674:Agrn APN 4 156174561 splice site probably benign
IGL02724:Agrn APN 4 156172807 nonsense probably null
IGL02804:Agrn APN 4 156174055 missense probably benign 0.00
IGL02986:Agrn APN 4 156178854 missense possibly damaging 0.84
IGL03160:Agrn APN 4 156170363 missense probably damaging 0.98
F6893:Agrn UTSW 4 156174179 missense probably benign
R0092:Agrn UTSW 4 156178953 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0100:Agrn UTSW 4 156174958 missense probably damaging 1.00
R0482:Agrn UTSW 4 156173555 missense probably damaging 0.98
R0531:Agrn UTSW 4 156179434 missense probably benign 0.38
R0536:Agrn UTSW 4 156179553 missense probably benign 0.01
R0690:Agrn UTSW 4 156174453 missense probably damaging 1.00
R0750:Agrn UTSW 4 156166937 nonsense probably null
R1079:Agrn UTSW 4 156177225 missense probably damaging 1.00
R1199:Agrn UTSW 4 156172299 missense probably benign 0.00
R1222:Agrn UTSW 4 156177385 missense probably damaging 0.99
R1534:Agrn UTSW 4 156176684 missense probably damaging 1.00
R1587:Agrn UTSW 4 156179440 missense probably damaging 0.99
R1625:Agrn UTSW 4 156172860 missense probably damaging 1.00
R1698:Agrn UTSW 4 156166558 missense probably benign 0.03
R1717:Agrn UTSW 4 156166519 frame shift probably null
R1718:Agrn UTSW 4 156166519 frame shift probably null
R1721:Agrn UTSW 4 156175173 nonsense probably null
R1765:Agrn UTSW 4 156176827 nonsense probably null
R1840:Agrn UTSW 4 156167415 missense probably damaging 1.00
R1865:Agrn UTSW 4 156166519 frame shift probably null
R2105:Agrn UTSW 4 156177299 nonsense probably null
R2265:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2266:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2269:Agrn UTSW 4 156179218 missense probably damaging 0.99
R2382:Agrn UTSW 4 156176516 missense probably damaging 0.97
R2497:Agrn UTSW 4 156173811 missense probably benign 0.28
R2509:Agrn UTSW 4 156166424 utr 3 prime probably null
R2510:Agrn UTSW 4 156166424 utr 3 prime probably null
R2511:Agrn UTSW 4 156166424 utr 3 prime probably null
R2994:Agrn UTSW 4 156167328 missense possibly damaging 0.79
R3824:Agrn UTSW 4 156169302 missense probably damaging 1.00
R4736:Agrn UTSW 4 156172401 missense probably benign 0.38
R4755:Agrn UTSW 4 156173522 intron probably benign
R4853:Agrn UTSW 4 156185550 critical splice donor site probably null
R4878:Agrn UTSW 4 156170845 missense probably damaging 1.00
R5117:Agrn UTSW 4 156185553 missense probably benign 0.30
R5228:Agrn UTSW 4 156166946 missense probably damaging 1.00
R5236:Agrn UTSW 4 156178858 missense possibly damaging 0.93
R5269:Agrn UTSW 4 156168990 missense probably benign 0.10
R5282:Agrn UTSW 4 156173035 missense probably damaging 1.00
R5449:Agrn UTSW 4 156167280 critical splice donor site probably null
R5560:Agrn UTSW 4 156178497 missense probably damaging 0.99
R5668:Agrn UTSW 4 156167313 missense probably damaging 0.97
R5967:Agrn UTSW 4 156175103 missense probably damaging 1.00
R6226:Agrn UTSW 4 156173609 missense probably damaging 0.96
R6338:Agrn UTSW 4 156170585 missense probably benign 0.17
R6351:Agrn UTSW 4 156179434 missense probably benign 0.00
R6437:Agrn UTSW 4 156176778 missense probably damaging 0.96
R6490:Agrn UTSW 4 156167362 nonsense probably null
R6909:Agrn UTSW 4 156177007 missense possibly damaging 0.90
R7110:Agrn UTSW 4 156178875 missense possibly damaging 0.88
R7123:Agrn UTSW 4 156172840 missense probably benign
R7163:Agrn UTSW 4 156178509 missense probably damaging 1.00
R7180:Agrn UTSW 4 156171839 missense probably benign 0.00
R7251:Agrn UTSW 4 156174606 missense probably damaging 1.00
R7289:Agrn UTSW 4 156178932 missense probably damaging 1.00
R7335:Agrn UTSW 4 156176532 missense probably damaging 1.00
R7336:Agrn UTSW 4 156174914 nonsense probably null
R7406:Agrn UTSW 4 156172301 missense possibly damaging 0.93
R7460:Agrn UTSW 4 156174424 missense probably damaging 0.98
R7531:Agrn UTSW 4 156169804 missense probably damaging 1.00
R7585:Agrn UTSW 4 156170674 missense probably benign 0.08
R7646:Agrn UTSW 4 156195354 missense probably damaging 0.99
R7652:Agrn UTSW 4 156169218 critical splice donor site probably null
R7714:Agrn UTSW 4 156195397 missense probably damaging 1.00
R7751:Agrn UTSW 4 156176429 missense probably damaging 1.00
R7852:Agrn UTSW 4 156169057 missense probably benign 0.01
R7935:Agrn UTSW 4 156169057 missense probably benign 0.01
R8039:Agrn UTSW 4 156169011 missense probably benign 0.12
R8056:Agrn UTSW 4 156170411 missense probably benign
R8061:Agrn UTSW 4 156178954 missense probably damaging 1.00
R8158:Agrn UTSW 4 156173889 missense probably benign
Z1177:Agrn UTSW 4 156171544 nonsense probably null
Z1177:Agrn UTSW 4 156179576 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAAACGCAGTCTAAGCCCAG -3'
(R):5'- TTTGCAGAGAGTGTTGCTCC -3'

Sequencing Primer
(F):5'- AGTCTAAGCCCAGCCCCG -3'
(R):5'- TGCATCTATGACCACCCCAAGG -3'
Posted On2017-01-03