Incidental Mutation 'R0552:Klhdc8b'
ID 45244
Institutional Source Beutler Lab
Gene Symbol Klhdc8b
Ensembl Gene ENSMUSG00000032609
Gene Name kelch domain containing 8B
Synonyms 4931406O17Rik
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock # R0552 (G1)
Quality Score 210
Status Not validated
Chromosome 9
Chromosomal Location 108447636-108461581 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 108449223 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 158 (R158G)
Ref Sequence ENSEMBL: ENSMUSP00000141558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035232] [ENSMUST00000057265] [ENSMUST00000193286] [ENSMUST00000193895] [ENSMUST00000195435]
AlphaFold Q9D2D9
Predicted Effect possibly damaging
Transcript: ENSMUST00000035232
AA Change: R204G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000035232
Gene: ENSMUSG00000032609
AA Change: R204G

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057265
SMART Domains Protein: ENSMUSP00000059069
Gene: ENSMUSG00000050641

DomainStartEndE-ValueType
Pfam:HDNR 3 156 1.7e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192955
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193159
Predicted Effect possibly damaging
Transcript: ENSMUST00000193286
AA Change: R204G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142325
Gene: ENSMUSG00000032609
AA Change: R204G

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000193895
AA Change: R204G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141453
Gene: ENSMUSG00000032609
AA Change: R204G

DomainStartEndE-ValueType
Kelch 32 79 2.08e-6 SMART
Kelch 80 127 1.9e-1 SMART
Kelch 128 174 1.76e-4 SMART
Kelch 176 222 3.74e-8 SMART
Kelch 239 281 8.33e0 SMART
Kelch 282 329 3.83e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193911
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194633
Predicted Effect possibly damaging
Transcript: ENSMUST00000195435
AA Change: R158G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000141558
Gene: ENSMUSG00000032609
AA Change: R158G

DomainStartEndE-ValueType
Kelch 32 79 7e-9 SMART
Kelch 80 127 6.3e-4 SMART
Kelch 128 176 1.5e-8 SMART
Kelch 193 235 2.8e-2 SMART
Kelch 236 283 1.3e-7 SMART
Meta Mutation Damage Score 0.1858 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which forms a distinct beta-propeller protein structure of kelch domains allowing for protein-protein interactions. Mutations in this gene have been associated with Hodgkin lymphoma. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Klhdc8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Klhdc8b APN 9 108448906 missense probably benign 0.41
R0537:Klhdc8b UTSW 9 108449223 missense possibly damaging 0.90
R1080:Klhdc8b UTSW 9 108449638 missense probably benign 0.29
R1595:Klhdc8b UTSW 9 108451163 missense probably damaging 0.99
R4976:Klhdc8b UTSW 9 108451187 missense probably damaging 1.00
R5024:Klhdc8b UTSW 9 108448985 intron probably benign
R5056:Klhdc8b UTSW 9 108448985 intron probably benign
R5327:Klhdc8b UTSW 9 108449042 intron probably benign
R5819:Klhdc8b UTSW 9 108451062 missense probably benign 0.20
R6265:Klhdc8b UTSW 9 108448425 missense probably damaging 1.00
R7420:Klhdc8b UTSW 9 108449118 missense possibly damaging 0.59
R8871:Klhdc8b UTSW 9 108449672 missense probably damaging 0.99
R9139:Klhdc8b UTSW 9 108449728 missense probably damaging 0.98
Z1176:Klhdc8b UTSW 9 108448377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACACAGACATATGCAGATGCAAG -3'
(R):5'- GCCCAACTGGGGTTGGAAAATCAC -3'

Sequencing Primer
(F):5'- acgcacgcacTCCCTTC -3'
(R):5'- CATGGTTACTCCATGAGCAGG -3'
Posted On 2013-06-11