Incidental Mutation 'R5725:Itgax'
ID452441
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 043343-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5725 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128147861 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 945 (T945A)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033053
AA Change: T945A

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: T945A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206396
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Agrn T A 4: 156,173,875 T938S probably benign Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Aplp2 T C 9: 31,157,814 D573G probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa T A 4: 65,189,410 V686E probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sept14 T C 5: 129,689,566 D317G probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Smg6 A G 11: 74,930,613 Q570R probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6004:Itgax UTSW 7 128131452 missense probably damaging 0.96
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TAGCTGTTCCTGCATGGCTC -3'
(R):5'- CAAAAGTTGATGCTGACTGGCAC -3'

Sequencing Primer
(F):5'- CCTTTCGCCCACCCTGAAG -3'
(R):5'- TGATGCTGACTGGCACGTCTC -3'
Posted On2017-01-03