Incidental Mutation 'R5725:Aplp2'
ID452445
Institutional Source Beutler Lab
Gene Symbol Aplp2
Ensembl Gene ENSMUSG00000031996
Gene Nameamyloid beta (A4) precursor-like protein 2
Synonyms
MMRRC Submission 043343-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5725 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location31149557-31211815 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31157814 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 573 (D573G)
Ref Sequence ENSEMBL: ENSMUSP00000149732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072634] [ENSMUST00000079758] [ENSMUST00000213254] [ENSMUST00000217641]
Predicted Effect probably damaging
Transcript: ENSMUST00000072634
AA Change: D573G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072428
Gene: ENSMUSG00000031996
AA Change: D573G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
KU 308 361 3.52e-24 SMART
Pfam:APP_E2 365 547 1.6e-71 PFAM
low complexity region 555 568 N/A INTRINSIC
low complexity region 589 595 N/A INTRINSIC
low complexity region 597 609 N/A INTRINSIC
Pfam:APP_amyloid 697 747 1.5e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079758
AA Change: D517G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078694
Gene: ENSMUSG00000031996
AA Change: D517G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
A4_EXTRA 42 204 7.91e-123 SMART
low complexity region 218 232 N/A INTRINSIC
coiled coil region 242 269 N/A INTRINSIC
Pfam:APP_E2 307 492 2.3e-75 PFAM
low complexity region 499 512 N/A INTRINSIC
low complexity region 533 539 N/A INTRINSIC
low complexity region 541 553 N/A INTRINSIC
Pfam:APP_amyloid 652 703 1.5e-32 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213254
AA Change: D573G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217516
Predicted Effect probably damaging
Transcript: ENSMUST00000217641
AA Change: D517G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217658
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes amyloid precursor- like protein 2 (APLP2), which is a member of the APP (amyloid precursor protein) family including APP, APLP1 and APLP2. This protein is ubiquitously expressed. It contains heparin-, copper- and zinc- binding domains at the N-terminus, BPTI/Kunitz inhibitor and E2 domains in the middle region, and transmembrane and intracellular domains at the C-terminus. This protein interacts with major histocompatibility complex (MHC) class I molecules. The synergy of this protein and the APP is required to mediate neuromuscular transmission, spatial learning and synaptic plasticity. This protein has been implicated in the pathogenesis of Alzheimer's disease. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for two different targeted alleles show embryonic lethality, or viability and fertility with increased copper levels in cerebral cortex and liver. Double knockouts with App show high mortality, reduced growth, and neurological symptoms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Agrn T A 4: 156,173,875 T938S probably benign Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itgax A G 7: 128,147,861 T945A possibly damaging Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa T A 4: 65,189,410 V686E probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sept14 T C 5: 129,689,566 D317G probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Smg6 A G 11: 74,930,613 Q570R probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Aplp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02067:Aplp2 APN 9 31150895 missense probably damaging 1.00
IGL02152:Aplp2 APN 9 31211651 missense unknown
IGL02309:Aplp2 APN 9 31167683 missense possibly damaging 0.80
IGL02407:Aplp2 APN 9 31158527 nonsense probably null
IGL02623:Aplp2 APN 9 31178083 splice site probably benign
IGL02737:Aplp2 APN 9 31153416 missense probably benign
IGL02958:Aplp2 APN 9 31164676 splice site probably benign
R0211:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R0279:Aplp2 UTSW 9 31157790 missense probably damaging 0.99
R1669:Aplp2 UTSW 9 31167733 intron probably benign
R1707:Aplp2 UTSW 9 31150919 missense probably damaging 1.00
R1755:Aplp2 UTSW 9 31177104 missense probably damaging 1.00
R2512:Aplp2 UTSW 9 31167677 missense probably damaging 1.00
R2842:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R4031:Aplp2 UTSW 9 31157730 missense probably benign 0.00
R4115:Aplp2 UTSW 9 31157826 missense probably benign 0.12
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6032:Aplp2 UTSW 9 31150944 missense probably damaging 1.00
R6375:Aplp2 UTSW 9 31157788 missense probably benign 0.00
R7170:Aplp2 UTSW 9 31170443 missense probably benign 0.03
R7541:Aplp2 UTSW 9 31152356 missense possibly damaging 0.82
R7584:Aplp2 UTSW 9 31157781 missense possibly damaging 0.56
R7711:Aplp2 UTSW 9 31161349 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTCCCTAGTGCAATCAGG -3'
(R):5'- TCCTATAAAGTCAGGCAGTAGGC -3'

Sequencing Primer
(F):5'- CTCCCTAGTGCAATCAGGTTTGAAG -3'
(R):5'- CTAGACATAGACAGGAAGTGGGTTGC -3'
Posted On2017-01-03