Incidental Mutation 'R5725:Smg6'
ID452454
Institutional Source Beutler Lab
Gene Symbol Smg6
Ensembl Gene ENSMUSG00000038290
Gene NameSmg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission 043343-MU
Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5725 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74925823-75164448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74930613 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 570 (Q570R)
Ref Sequence ENSEMBL: ENSMUSP00000043555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000065211] [ENSMUST00000108447] [ENSMUST00000108448] [ENSMUST00000121738] [ENSMUST00000123855] [ENSMUST00000128556] [ENSMUST00000138612]
Predicted Effect probably benign
Transcript: ENSMUST00000045281
AA Change: Q570R

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290
AA Change: Q570R

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065211
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108447
SMART Domains Protein: ENSMUSP00000104086
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 179 1.8e-41 PFAM
Pfam:PALP 173 289 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108448
SMART Domains Protein: ENSMUSP00000104087
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121738
SMART Domains Protein: ENSMUSP00000113372
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123855
SMART Domains Protein: ENSMUSP00000118485
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 166 1.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127499
Predicted Effect probably benign
Transcript: ENSMUST00000128556
SMART Domains Protein: ENSMUSP00000120012
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 182 2.6e-44 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000130145
AA Change: Q31R
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290
AA Change: Q31R

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135587
Predicted Effect probably benign
Transcript: ENSMUST00000138612
SMART Domains Protein: ENSMUSP00000119256
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 112 4.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147817
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Agrn T A 4: 156,173,875 T938S probably benign Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Aplp2 T C 9: 31,157,814 D573G probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itgax A G 7: 128,147,861 T945A possibly damaging Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa T A 4: 65,189,410 V686E probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sept14 T C 5: 129,689,566 D317G probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Smg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Smg6 APN 11 74929148 missense probably benign
IGL01146:Smg6 APN 11 74930428 nonsense probably null
IGL01505:Smg6 APN 11 75156291 missense probably damaging 1.00
IGL01541:Smg6 APN 11 74925944 missense probably benign 0.43
IGL01636:Smg6 APN 11 74935103 critical splice donor site probably null
IGL02379:Smg6 APN 11 75053925 missense probably damaging 1.00
IGL02794:Smg6 APN 11 75053934 missense probably damaging 0.99
IGL02964:Smg6 APN 11 74930750 critical splice donor site probably null
IGL03057:Smg6 APN 11 74935434 nonsense probably null
1mM(1):Smg6 UTSW 11 74934989 splice site probably benign
IGL03097:Smg6 UTSW 11 74932426 missense probably damaging 1.00
PIT4802001:Smg6 UTSW 11 75156165 missense probably damaging 0.96
R0269:Smg6 UTSW 11 75162931 missense probably benign
R0344:Smg6 UTSW 11 74929821 missense probably damaging 1.00
R0437:Smg6 UTSW 11 74929701 missense probably damaging 1.00
R0452:Smg6 UTSW 11 74930213 missense probably benign
R0511:Smg6 UTSW 11 74929058 missense probably damaging 1.00
R0617:Smg6 UTSW 11 75162931 missense probably benign
R0737:Smg6 UTSW 11 75159836 missense probably damaging 1.00
R1715:Smg6 UTSW 11 74929430 missense probably benign
R1780:Smg6 UTSW 11 74946116 missense probably damaging 1.00
R1927:Smg6 UTSW 11 75142848 missense probably damaging 1.00
R2073:Smg6 UTSW 11 74930294 missense probably damaging 1.00
R2171:Smg6 UTSW 11 75038646 missense probably damaging 1.00
R2513:Smg6 UTSW 11 74929676 missense probably damaging 1.00
R3943:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R3944:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R4275:Smg6 UTSW 11 74993874 intron probably benign
R4369:Smg6 UTSW 11 74932443 nonsense probably null
R4452:Smg6 UTSW 11 74990141 missense probably benign 0.14
R4864:Smg6 UTSW 11 74930162 missense possibly damaging 0.89
R4885:Smg6 UTSW 11 75041918 missense probably damaging 1.00
R5043:Smg6 UTSW 11 74929895 missense possibly damaging 0.86
R5189:Smg6 UTSW 11 75041996 missense probably damaging 1.00
R5378:Smg6 UTSW 11 75041994 missense possibly damaging 0.61
R5518:Smg6 UTSW 11 75053898 missense probably damaging 0.99
R5746:Smg6 UTSW 11 75139287 missense probably damaging 1.00
R6151:Smg6 UTSW 11 75156207 missense probably damaging 0.96
R6319:Smg6 UTSW 11 75156222 missense probably damaging 1.00
R6349:Smg6 UTSW 11 75053774 missense possibly damaging 0.94
R6500:Smg6 UTSW 11 74930505 missense possibly damaging 0.74
R6619:Smg6 UTSW 11 74932453 critical splice donor site probably null
R6820:Smg6 UTSW 11 75041964 missense probably damaging 0.99
R6923:Smg6 UTSW 11 74929343 missense possibly damaging 0.50
R7361:Smg6 UTSW 11 74930153 missense probably benign 0.00
R7494:Smg6 UTSW 11 74929623 missense probably benign
R7498:Smg6 UTSW 11 74929106 missense probably benign 0.01
R7681:Smg6 UTSW 11 74931705 missense probably damaging 1.00
R7710:Smg6 UTSW 11 74930619 missense probably benign 0.26
R7770:Smg6 UTSW 11 74993861 missense unknown
R8159:Smg6 UTSW 11 75038639 missense probably damaging 1.00
R8381:Smg6 UTSW 11 74931740 missense probably damaging 1.00
R8509:Smg6 UTSW 11 75041876 missense probably benign 0.04
X0018:Smg6 UTSW 11 74929986 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GTCAGGCCCAAGCATCTTAC -3'
(R):5'- CTCTCTAAGCAAGACAGTAGGAAAG -3'

Sequencing Primer
(F):5'- TATTATTACCCTCGGACACCAGG -3'
(R):5'- TAGGAAAGAACACTCAGTACCTG -3'
Posted On2017-01-03