Mutagenetix > Incidental Mutations

Incidental Mutation 'R5725:2700049A03Rik'

452459

Institutional Source

Beutler Lab

Gene Symbol

2700049A03Rik

Ensembl Gene

ENSMUSG00000034601

Gene Name

RIKEN cDNA 2700049A03 gene

Synonyms

talpid3

MMRRC Submission

043343-MU

Accession Numbers

Genbank: NM_001163378, NM_029818

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5725 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

71136848-71243303 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 71193319 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 1301 (R1301H)

Ref Sequence

ENSEMBL: ENSMUSP00000118956 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045907] [ENSMUST00000149564]

Predicted Effect

probably benign
Transcript: ENSMUST00000045907
AA Change: R1301H

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000044701
Gene: ENSMUSG00000034601
AA Change: R1301H

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1351	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149564
AA Change: R1301H

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000118956
Gene: ENSMUSG00000034601
AA Change: R1301H

Domain	Start	End	E-Value	Type
Pfam:TALPID3	116	1349	N/A	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved centrosomal protein that functions in ciliogenesis and responds to hedgehog signaling. Mutations in this gene causes Joubert syndrome 23. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele die during organogenesis, lack cilia, and show randomized L-R patterning, face and neural tube defects, pericardial edema and hemorrhages. Mouse embryonic fibroblasts homozygous for a different null allele lack cilia and asymmetrical centriolar localization. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Targeted, other(2) Gene trapped(10)

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030468B19Rik	G	T	11: 117,806,057	S201I	probably damaging	Het
Abca13	G	A	11: 9,577,181	M4531I	probably benign	Het
Abca2	A	G	2: 25,439,400	M1058V	probably damaging	Het
Agrn	T	A	4: 156,173,875	T938S	probably benign	Het
Aloxe3	A	T	11: 69,128,654	D131V	probably null	Het
Angptl7	C	A	4: 148,496,508	A277S	possibly damaging	Het
Ap5z1	T	C	5: 142,468,976	M244T	probably damaging	Het
Aplp2	T	C	9: 31,157,814	D573G	probably damaging	Het
Arid5a	G	T	1: 36,319,130	E176*	probably null	Het
Atp8b4	A	T	2: 126,433,936	N125K	probably benign	Het
Auts2	A	G	5: 131,439,746	V911A	probably benign	Het
Bahcc1	G	A	11: 120,274,888	R990H	probably benign	Het
Cd84	T	C	1: 171,873,361	F230L	probably benign	Het
Dtnb	T	A	12: 3,773,566	L584H	probably damaging	Het
Dync2h1	A	C	9: 7,169,528	S316R	probably benign	Het
Eif3m	A	G	2: 105,013,841	I73T	probably damaging	Het
Emilin3	A	T	2: 160,908,490	C399*	probably null	Het
Fam118a	A	G	15: 85,045,621	K17E	probably damaging	Het
Fat4	A	G	3: 38,889,625	N889S	probably damaging	Het
Hmcn2	G	A	2: 31,383,815		probably null	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Igsf21	T	C	4: 140,034,743	D208G	probably benign	Het
Itgax	A	G	7: 128,147,861	T945A	possibly damaging	Het
Itsn2	T	A	12: 4,630,767		probably benign	Het
Kcna4	A	G	2: 107,296,876	T652A	possibly damaging	Het
Kir3dl1	G	A	X: 136,526,482	D56N	probably damaging	Het
Lrp4	A	G	2: 91,494,895	Y1355C	probably damaging	Het
Mkl2	A	T	16: 13,384,310	K146*	probably null	Het
Mmp9	C	A	2: 164,949,336	A142E	possibly damaging	Het
Mpeg1	T	C	19: 12,462,636	V486A	probably benign	Het
Mrgprb3	A	T	7: 48,643,800	M1K	probably null	Het
Nacad	T	C	11: 6,601,643	E516G	probably benign	Het
Olfr178	G	A	16: 58,889,887	T111I	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pappa	T	A	4: 65,189,410	V686E	probably damaging	Het
Polr3a	A	T	14: 24,465,387		probably null	Het
Ppp1r3a	A	G	6: 14,719,349	V522A	probably benign	Het
Rab6b	T	A	9: 103,163,862	F152I	probably damaging	Het
Sacs	G	A	14: 61,211,110	R3535Q	probably damaging	Het
Sept14	T	C	5: 129,689,566	D317G	probably damaging	Het
Sin3b	T	C	8: 72,725,692		probably null	Het
Sis	G	A	3: 72,965,598	P69L	probably damaging	Het
Slc12a3	G	T	8: 94,330,446	V116L	probably benign	Het
Slc16a12	A	T	19: 34,674,827	F306L	probably damaging	Het
Slc39a12	T	C	2: 14,389,264		probably benign	Het
Smg6	A	G	11: 74,930,613	Q570R	probably benign	Het
Sptb	G	A	12: 76,623,114	A480V	probably benign	Het
Srsf4	C	A	4: 131,900,951		probably benign	Het
Topors	T	C	4: 40,261,952	D444G	probably damaging	Het
Trav19	A	C	14: 53,845,542	T25P	possibly damaging	Het
Trim3	A	G	7: 105,617,740		probably null	Het
Ugt2a2	T	C	5: 87,474,896	N281S	probably damaging	Het
Vmn1r12	A	G	6: 57,159,709	I264V	probably benign	Het
Vmn2r94	T	A	17: 18,256,227	I403F	possibly damaging	Het
Zzef1	G	A	11: 72,855,482	R870Q	possibly damaging	Het

Other mutations in 2700049A03Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:2700049A03Rik	APN	12	71167119	missense	probably benign	0.00
IGL01107:2700049A03Rik	APN	12	71194468	critical splice donor site	probably null
IGL01404:2700049A03Rik	APN	12	71164378	splice site	probably null
IGL01835:2700049A03Rik	APN	12	71167181	nonsense	probably null
IGL01835:2700049A03Rik	APN	12	71167183	missense	probably benign	0.00
IGL02122:2700049A03Rik	APN	12	71170525	missense	possibly damaging	0.93
IGL02140:2700049A03Rik	APN	12	71148260	missense	probably benign	0.06
IGL02385:2700049A03Rik	APN	12	71154856	missense	probably damaging	0.98
IGL03181:2700049A03Rik	APN	12	71193373	missense	possibly damaging	0.51
IGL03253:2700049A03Rik	APN	12	71140883	missense	probably benign	0.33
IGL03278:2700049A03Rik	APN	12	71158825	splice site	probably benign
G4846:2700049A03Rik	UTSW	12	71137909	missense	probably benign
PIT1430001:2700049A03Rik	UTSW	12	71160386	missense	possibly damaging	0.71
PIT4519001:2700049A03Rik	UTSW	12	71170666	missense	probably benign	0.05
R0108:2700049A03Rik	UTSW	12	71177918	missense	probably benign	0.14
R0165:2700049A03Rik	UTSW	12	71167150	missense	possibly damaging	0.52
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0211:2700049A03Rik	UTSW	12	71216096	missense	possibly damaging	0.96
R0220:2700049A03Rik	UTSW	12	71148420	critical splice donor site	probably null
R0352:2700049A03Rik	UTSW	12	71138030	missense	possibly damaging	0.96
R0468:2700049A03Rik	UTSW	12	71193310	missense	possibly damaging	0.71
R0508:2700049A03Rik	UTSW	12	71164388	missense	probably damaging	0.98
R0673:2700049A03Rik	UTSW	12	71177868	missense	probably damaging	0.97
R0840:2700049A03Rik	UTSW	12	71158883	missense	probably benign	0.16
R0893:2700049A03Rik	UTSW	12	71219308	splice site	probably benign
R1244:2700049A03Rik	UTSW	12	71216144	missense	probably benign	0.25
R1432:2700049A03Rik	UTSW	12	71170587	splice site	probably null
R1599:2700049A03Rik	UTSW	12	71150259	missense	probably damaging	0.98
R1732:2700049A03Rik	UTSW	12	71219221	missense	probably benign	0.18
R1820:2700049A03Rik	UTSW	12	71150244	missense	possibly damaging	0.51
R1939:2700049A03Rik	UTSW	12	71160412	splice site	probably null
R1998:2700049A03Rik	UTSW	12	71188619	missense	possibly damaging	0.86
R2337:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2337:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2340:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2340:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2382:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2382:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2384:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2384:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2445:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2445:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2449:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R2449:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R2512:2700049A03Rik	UTSW	12	71173171	missense	possibly damaging	0.71
R2872:2700049A03Rik	UTSW	12	71154756	splice site	probably benign
R3236:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3236:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3237:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3237:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3734:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3734:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3808:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3808:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3809:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3809:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3944:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3944:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R3960:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R3960:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4593:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4593:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4595:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4595:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4596:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4596:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4600:2700049A03Rik	UTSW	12	71148263	missense	possibly damaging	0.67
R4649:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4649:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4651:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4651:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4652:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4652:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4714:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4714:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4735:2700049A03Rik	UTSW	12	71216123	missense	possibly damaging	0.88
R4810:2700049A03Rik	UTSW	12	71189442	missense	possibly damaging	0.51
R4852:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4852:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4854:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4854:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4855:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4855:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4884:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4884:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4893:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4893:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4905:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4905:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4915:2700049A03Rik	UTSW	12	71189646	missense	possibly damaging	0.92
R4919:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4919:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4959:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4959:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R4989:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R4989:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5011:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5011:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5012:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5012:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5118:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5118:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5146:2700049A03Rik	UTSW	12	71243025	missense	possibly damaging	0.85
R5163:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5163:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5188:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5188:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5189:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5189:2700049A03Rik	UTSW	12	71193349	missense	possibly damaging	0.93
R5190:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5190:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5290:2700049A03Rik	UTSW	12	71188791	missense	probably benign	0.00
R5344:2700049A03Rik	UTSW	12	71243027	missense	probably benign
R5502:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5502:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5503:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5503:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5619:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5619:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5667:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5667:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5669:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5669:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5671:2700049A03Rik	UTSW	12	71164546	nonsense	probably null
R5671:2700049A03Rik	UTSW	12	71164547	missense	possibly damaging	0.93
R5956:2700049A03Rik	UTSW	12	71157119	missense	possibly damaging	0.86
R6051:2700049A03Rik	UTSW	12	71184530	missense	possibly damaging	0.84
R6148:2700049A03Rik	UTSW	12	71187426	missense	possibly damaging	0.71
R6158:2700049A03Rik	UTSW	12	71170636	missense	possibly damaging	0.51
R6916:2700049A03Rik	UTSW	12	71164544	missense	possibly damaging	0.86
R7129:2700049A03Rik	UTSW	12	71216230	splice site	probably null
R7168:2700049A03Rik	UTSW	12	71216057	missense	probably damaging	0.98
R7193:2700049A03Rik	UTSW	12	71219189	critical splice acceptor site	probably null
R7200:2700049A03Rik	UTSW	12	71140906	missense	probably damaging	0.96
R7359:2700049A03Rik	UTSW	12	71189574	missense	possibly damaging	0.51
R7488:2700049A03Rik	UTSW	12	71150405	missense	possibly damaging	0.67
R7755:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02
R7757:2700049A03Rik	UTSW	12	71189413	missense	probably benign	0.02
R7922:2700049A03Rik	UTSW	12	71164406	missense	possibly damaging	0.83
R7966:2700049A03Rik	UTSW	12	71173129	missense	probably benign	0.00
R8082:2700049A03Rik	UTSW	12	71142121	critical splice donor site	probably null
R8311:2700049A03Rik	UTSW	12	71138041	unclassified	probably benign
R8408:2700049A03Rik	UTSW	12	71189582	missense	possibly damaging	0.71
Z1177:2700049A03Rik	UTSW	12	71164484	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGTCAAATGGCAATGAGAGCTAC -3'
(R):5'- TAGGTTAAAAGGACCATGACTCTG -3'

Sequencing Primer
(F):5'- GCTACATGACAATAGTGAGCTCATC -3'
(R):5'- CCCCCCAAAAATCTTTATGG -3'

Posted On

2017-01-03