Incidental Mutation 'R5725:Sptb'
ID452460
Institutional Source Beutler Lab
Gene Symbol Sptb
Ensembl Gene ENSMUSG00000021061
Gene Namespectrin beta, erythrocytic
SynonymsLOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1
MMRRC Submission 043343-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.876) question?
Stock #R5725 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76580488-76710547 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76623114 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 480 (A480V)
Ref Sequence ENSEMBL: ENSMUSP00000129782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]
Predicted Effect probably benign
Transcript: ENSMUST00000021458
AA Change: A480V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: A480V

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.04e-10 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2193 4.32e-9 SMART
PH 2180 2291 8.98e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166101
AA Change: A480V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: A480V

DomainStartEndE-ValueType
CH 56 156 2.73e-26 SMART
CH 175 273 4.57e-28 SMART
SPEC 305 411 2.71e0 SMART
SPEC 425 525 4.65e-23 SMART
SPEC 531 634 4.51e-21 SMART
SPEC 640 740 3.02e-31 SMART
SPEC 746 845 1.47e-20 SMART
SPEC 851 951 1.04e-20 SMART
SPEC 957 1058 7.22e-20 SMART
SPEC 1064 1165 2.06e-24 SMART
SPEC 1171 1271 3.84e-15 SMART
SPEC 1277 1376 2.22e-20 SMART
SPEC 1382 1475 5.87e-11 SMART
SPEC 1481 1581 3.58e-24 SMART
SPEC 1587 1687 4.11e-24 SMART
SPEC 1693 1794 2.91e-24 SMART
SPEC 1800 1900 7.8e-16 SMART
SPEC 1906 2006 3.16e-25 SMART
SPEC 2012 2117 1.16e-9 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G A 12: 71,193,319 R1301H probably benign Het
6030468B19Rik G T 11: 117,806,057 S201I probably damaging Het
Abca13 G A 11: 9,577,181 M4531I probably benign Het
Abca2 A G 2: 25,439,400 M1058V probably damaging Het
Agrn T A 4: 156,173,875 T938S probably benign Het
Aloxe3 A T 11: 69,128,654 D131V probably null Het
Angptl7 C A 4: 148,496,508 A277S possibly damaging Het
Ap5z1 T C 5: 142,468,976 M244T probably damaging Het
Aplp2 T C 9: 31,157,814 D573G probably damaging Het
Arid5a G T 1: 36,319,130 E176* probably null Het
Atp8b4 A T 2: 126,433,936 N125K probably benign Het
Auts2 A G 5: 131,439,746 V911A probably benign Het
Bahcc1 G A 11: 120,274,888 R990H probably benign Het
Cd84 T C 1: 171,873,361 F230L probably benign Het
Dtnb T A 12: 3,773,566 L584H probably damaging Het
Dync2h1 A C 9: 7,169,528 S316R probably benign Het
Eif3m A G 2: 105,013,841 I73T probably damaging Het
Emilin3 A T 2: 160,908,490 C399* probably null Het
Fam118a A G 15: 85,045,621 K17E probably damaging Het
Fat4 A G 3: 38,889,625 N889S probably damaging Het
Hmcn2 G A 2: 31,383,815 probably null Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Igsf21 T C 4: 140,034,743 D208G probably benign Het
Itgax A G 7: 128,147,861 T945A possibly damaging Het
Itsn2 T A 12: 4,630,767 probably benign Het
Kcna4 A G 2: 107,296,876 T652A possibly damaging Het
Kir3dl1 G A X: 136,526,482 D56N probably damaging Het
Lrp4 A G 2: 91,494,895 Y1355C probably damaging Het
Mkl2 A T 16: 13,384,310 K146* probably null Het
Mmp9 C A 2: 164,949,336 A142E possibly damaging Het
Mpeg1 T C 19: 12,462,636 V486A probably benign Het
Mrgprb3 A T 7: 48,643,800 M1K probably null Het
Nacad T C 11: 6,601,643 E516G probably benign Het
Olfr178 G A 16: 58,889,887 T111I possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pappa T A 4: 65,189,410 V686E probably damaging Het
Polr3a A T 14: 24,465,387 probably null Het
Ppp1r3a A G 6: 14,719,349 V522A probably benign Het
Rab6b T A 9: 103,163,862 F152I probably damaging Het
Sacs G A 14: 61,211,110 R3535Q probably damaging Het
Sept14 T C 5: 129,689,566 D317G probably damaging Het
Sin3b T C 8: 72,725,692 probably null Het
Sis G A 3: 72,965,598 P69L probably damaging Het
Slc12a3 G T 8: 94,330,446 V116L probably benign Het
Slc16a12 A T 19: 34,674,827 F306L probably damaging Het
Slc39a12 T C 2: 14,389,264 probably benign Het
Smg6 A G 11: 74,930,613 Q570R probably benign Het
Srsf4 C A 4: 131,900,951 probably benign Het
Topors T C 4: 40,261,952 D444G probably damaging Het
Trav19 A C 14: 53,845,542 T25P possibly damaging Het
Trim3 A G 7: 105,617,740 probably null Het
Ugt2a2 T C 5: 87,474,896 N281S probably damaging Het
Vmn1r12 A G 6: 57,159,709 I264V probably benign Het
Vmn2r94 T A 17: 18,256,227 I403F possibly damaging Het
Zzef1 G A 11: 72,855,482 R870Q possibly damaging Het
Other mutations in Sptb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Sptb APN 12 76621331 missense probably benign 0.00
IGL00160:Sptb APN 12 76623169 missense probably damaging 1.00
IGL00229:Sptb APN 12 76620753 missense probably benign 0.20
IGL00820:Sptb APN 12 76632477 missense probably damaging 1.00
IGL01309:Sptb APN 12 76587463 missense probably benign 0.16
IGL01408:Sptb APN 12 76613147 missense possibly damaging 0.93
IGL01450:Sptb APN 12 76624240 missense possibly damaging 0.89
IGL01455:Sptb APN 12 76612912 missense probably damaging 1.00
IGL01457:Sptb APN 12 76612555 splice site probably benign
IGL01680:Sptb APN 12 76630682 missense probably damaging 1.00
IGL02070:Sptb APN 12 76605539 missense possibly damaging 0.82
IGL02346:Sptb APN 12 76621014 missense probably damaging 1.00
IGL02452:Sptb APN 12 76609036 critical splice donor site probably null
IGL02515:Sptb APN 12 76606487 missense possibly damaging 0.51
IGL02545:Sptb APN 12 76607980 critical splice donor site probably null
IGL02644:Sptb APN 12 76605617 missense probably damaging 1.00
IGL02878:Sptb APN 12 76620753 missense probably benign 0.20
IGL03007:Sptb APN 12 76621341 missense probably damaging 1.00
IGL03220:Sptb APN 12 76612910 missense probably benign 0.06
IGL03343:Sptb APN 12 76583556 unclassified probably benign
IGL03098:Sptb UTSW 12 76621499 missense probably damaging 1.00
PIT4472001:Sptb UTSW 12 76620686 missense probably damaging 1.00
R0047:Sptb UTSW 12 76622950 missense probably damaging 0.99
R0365:Sptb UTSW 12 76600383 missense probably benign 0.12
R0373:Sptb UTSW 12 76621371 missense probably benign 0.03
R0704:Sptb UTSW 12 76583594 missense probably damaging 0.99
R1005:Sptb UTSW 12 76601859 critical splice donor site probably null
R1109:Sptb UTSW 12 76603603 missense probably damaging 1.00
R1264:Sptb UTSW 12 76612607 missense probably damaging 1.00
R1358:Sptb UTSW 12 76621321 frame shift probably null
R1358:Sptb UTSW 12 76621326 missense probably damaging 1.00
R1459:Sptb UTSW 12 76611883 missense probably benign 0.01
R1518:Sptb UTSW 12 76604024 missense possibly damaging 0.95
R1628:Sptb UTSW 12 76583848 missense probably damaging 1.00
R1668:Sptb UTSW 12 76621169 missense probably benign
R1677:Sptb UTSW 12 76629649 missense probably damaging 1.00
R1687:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R1695:Sptb UTSW 12 76620867 missense probably benign 0.10
R1708:Sptb UTSW 12 76612574 missense probably damaging 1.00
R1761:Sptb UTSW 12 76612608 missense probably damaging 0.96
R1925:Sptb UTSW 12 76622253 missense probably damaging 1.00
R2011:Sptb UTSW 12 76632472 missense possibly damaging 0.95
R2373:Sptb UTSW 12 76621161 missense probably damaging 1.00
R2517:Sptb UTSW 12 76649869 missense possibly damaging 0.55
R2918:Sptb UTSW 12 76598758 missense probably damaging 0.97
R2961:Sptb UTSW 12 76603582 missense probably benign 0.19
R3409:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3410:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3411:Sptb UTSW 12 76610815 missense possibly damaging 0.78
R3744:Sptb UTSW 12 76600400 missense probably benign
R4112:Sptb UTSW 12 76597779 missense probably damaging 0.99
R4177:Sptb UTSW 12 76613179 missense probably benign 0.25
R4194:Sptb UTSW 12 76613010 missense probably benign 0.44
R4301:Sptb UTSW 12 76612697 missense probably damaging 1.00
R4555:Sptb UTSW 12 76612851 missense probably benign 0.03
R4619:Sptb UTSW 12 76583807 nonsense probably null
R4620:Sptb UTSW 12 76583807 nonsense probably null
R4625:Sptb UTSW 12 76587326 splice site probably null
R4728:Sptb UTSW 12 76583379 missense probably benign 0.00
R4751:Sptb UTSW 12 76627110 missense probably benign 0.07
R4810:Sptb UTSW 12 76623197 nonsense probably null
R4888:Sptb UTSW 12 76609037 missense probably benign 0.00
R4894:Sptb UTSW 12 76624994 critical splice donor site probably null
R5114:Sptb UTSW 12 76609278 missense probably damaging 1.00
R5191:Sptb UTSW 12 76612834 missense probably benign 0.12
R5479:Sptb UTSW 12 76599851 missense probably benign 0.04
R5646:Sptb UTSW 12 76587441 missense probably benign
R5727:Sptb UTSW 12 76623114 missense probably benign 0.25
R5797:Sptb UTSW 12 76603699 missense possibly damaging 0.95
R5874:Sptb UTSW 12 76598727 missense possibly damaging 0.91
R5952:Sptb UTSW 12 76632384 missense probably benign 0.02
R5956:Sptb UTSW 12 76604168 missense probably benign
R6298:Sptb UTSW 12 76620654 critical splice donor site probably null
R6470:Sptb UTSW 12 76612829 missense probably damaging 1.00
R6477:Sptb UTSW 12 76606392 missense probably damaging 1.00
R6736:Sptb UTSW 12 76613180 missense possibly damaging 0.49
R6854:Sptb UTSW 12 76603480 missense probably damaging 1.00
R6969:Sptb UTSW 12 76608007 missense probably damaging 1.00
R6987:Sptb UTSW 12 76613247 missense probably benign 0.00
R7023:Sptb UTSW 12 76625088 missense probably damaging 1.00
R7366:Sptb UTSW 12 76604194 missense probably damaging 1.00
R7379:Sptb UTSW 12 76610877 missense probably damaging 1.00
R7389:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7392:Sptb UTSW 12 76624229 missense probably damaging 0.98
R7477:Sptb UTSW 12 76628565 missense probably damaging 1.00
R7653:Sptb UTSW 12 76628497 missense probably benign 0.06
R7684:Sptb UTSW 12 76612195 missense probably benign 0.06
R7733:Sptb UTSW 12 76597921 intron probably null
R7846:Sptb UTSW 12 76608526 nonsense probably null
R7929:Sptb UTSW 12 76608526 nonsense probably null
R8048:Sptb UTSW 12 76628559 missense probably benign 0.02
X0057:Sptb UTSW 12 76630739 missense probably benign
Z1176:Sptb UTSW 12 76620733 nonsense probably null
Z1177:Sptb UTSW 12 76583584 missense probably damaging 1.00
Z1177:Sptb UTSW 12 76606445 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TCATCCATCCAATCGATGCTG -3'
(R):5'- TTTCCCGTGTGACAGCTCTG -3'

Sequencing Primer
(F):5'- ATCCAATCGATGCTGTGCAG -3'
(R):5'- TGTGACAGCTCTGCCTGAG -3'
Posted On2017-01-03