Mutagenetix > Incidental Mutations

Incidental Mutation 'R5725:Sptb'

452460

Institutional Source

Beutler Lab

Gene Symbol

Sptb

Ensembl Gene

ENSMUSG00000021061

Gene Name

spectrin beta, erythrocytic

Synonyms

LOC383567, spectrin R, D330027P03Rik, brain erythroid spectrin (235E), Spnb-1, Spnb1

MMRRC Submission

043343-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.876) question?

Stock #

R5725 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76580488-76710547 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 76623114 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 480 (A480V)

Ref Sequence

ENSEMBL: ENSMUSP00000129782 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021458] [ENSMUST00000166101]

Predicted Effect

probably benign
Transcript: ENSMUST00000021458
AA Change: A480V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000021458
Gene: ENSMUSG00000021061
AA Change: A480V

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.04e-10	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2193	4.32e-9	SMART
PH	2180	2291	8.98e-16	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000166101
AA Change: A480V

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000129782
Gene: ENSMUSG00000021061
AA Change: A480V

Domain	Start	End	E-Value	Type
CH	56	156	2.73e-26	SMART
CH	175	273	4.57e-28	SMART
SPEC	305	411	2.71e0	SMART
SPEC	425	525	4.65e-23	SMART
SPEC	531	634	4.51e-21	SMART
SPEC	640	740	3.02e-31	SMART
SPEC	746	845	1.47e-20	SMART
SPEC	851	951	1.04e-20	SMART
SPEC	957	1058	7.22e-20	SMART
SPEC	1064	1165	2.06e-24	SMART
SPEC	1171	1271	3.84e-15	SMART
SPEC	1277	1376	2.22e-20	SMART
SPEC	1382	1475	5.87e-11	SMART
SPEC	1481	1581	3.58e-24	SMART
SPEC	1587	1687	4.11e-24	SMART
SPEC	1693	1794	2.91e-24	SMART
SPEC	1800	1900	7.8e-16	SMART
SPEC	1906	2006	3.16e-25	SMART
SPEC	2012	2117	1.16e-9	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a member of the spectrin gene family. Spectrin proteins, along with ankyrin, play a role in cell membrane organization and stability. The protein encoded by this locus functions in stability of erythrocyte membranes, and mutations in this gene have been associated with spherocytosis type 2, hereditary elliptocytosis, and neonatal hemolytic anemia. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit a severe microcytic anemia with erythrocyte fragility, hepatomegaly, and jaundice. Mutants die within a few days of birth. Heterozygotes are mildly anemic. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	A	12: 71,193,319	R1301H	probably benign	Het
6030468B19Rik	G	T	11: 117,806,057	S201I	probably damaging	Het
Abca13	G	A	11: 9,577,181	M4531I	probably benign	Het
Abca2	A	G	2: 25,439,400	M1058V	probably damaging	Het
Agrn	T	A	4: 156,173,875	T938S	probably benign	Het
Aloxe3	A	T	11: 69,128,654	D131V	probably null	Het
Angptl7	C	A	4: 148,496,508	A277S	possibly damaging	Het
Ap5z1	T	C	5: 142,468,976	M244T	probably damaging	Het
Aplp2	T	C	9: 31,157,814	D573G	probably damaging	Het
Arid5a	G	T	1: 36,319,130	E176*	probably null	Het
Atp8b4	A	T	2: 126,433,936	N125K	probably benign	Het
Auts2	A	G	5: 131,439,746	V911A	probably benign	Het
Bahcc1	G	A	11: 120,274,888	R990H	probably benign	Het
Cd84	T	C	1: 171,873,361	F230L	probably benign	Het
Dtnb	T	A	12: 3,773,566	L584H	probably damaging	Het
Dync2h1	A	C	9: 7,169,528	S316R	probably benign	Het
Eif3m	A	G	2: 105,013,841	I73T	probably damaging	Het
Emilin3	A	T	2: 160,908,490	C399*	probably null	Het
Fam118a	A	G	15: 85,045,621	K17E	probably damaging	Het
Fat4	A	G	3: 38,889,625	N889S	probably damaging	Het
Hmcn2	G	A	2: 31,383,815		probably null	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Igsf21	T	C	4: 140,034,743	D208G	probably benign	Het
Itgax	A	G	7: 128,147,861	T945A	possibly damaging	Het
Itsn2	T	A	12: 4,630,767		probably benign	Het
Kcna4	A	G	2: 107,296,876	T652A	possibly damaging	Het
Kir3dl1	G	A	X: 136,526,482	D56N	probably damaging	Het
Lrp4	A	G	2: 91,494,895	Y1355C	probably damaging	Het
Mkl2	A	T	16: 13,384,310	K146*	probably null	Het
Mmp9	C	A	2: 164,949,336	A142E	possibly damaging	Het
Mpeg1	T	C	19: 12,462,636	V486A	probably benign	Het
Mrgprb3	A	T	7: 48,643,800	M1K	probably null	Het
Nacad	T	C	11: 6,601,643	E516G	probably benign	Het
Olfr178	G	A	16: 58,889,887	T111I	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Pappa	T	A	4: 65,189,410	V686E	probably damaging	Het
Polr3a	A	T	14: 24,465,387		probably null	Het
Ppp1r3a	A	G	6: 14,719,349	V522A	probably benign	Het
Rab6b	T	A	9: 103,163,862	F152I	probably damaging	Het
Sacs	G	A	14: 61,211,110	R3535Q	probably damaging	Het
Sept14	T	C	5: 129,689,566	D317G	probably damaging	Het
Sin3b	T	C	8: 72,725,692		probably null	Het
Sis	G	A	3: 72,965,598	P69L	probably damaging	Het
Slc12a3	G	T	8: 94,330,446	V116L	probably benign	Het
Slc16a12	A	T	19: 34,674,827	F306L	probably damaging	Het
Slc39a12	T	C	2: 14,389,264		probably benign	Het
Smg6	A	G	11: 74,930,613	Q570R	probably benign	Het
Srsf4	C	A	4: 131,900,951		probably benign	Het
Topors	T	C	4: 40,261,952	D444G	probably damaging	Het
Trav19	A	C	14: 53,845,542	T25P	possibly damaging	Het
Trim3	A	G	7: 105,617,740		probably null	Het
Ugt2a2	T	C	5: 87,474,896	N281S	probably damaging	Het
Vmn1r12	A	G	6: 57,159,709	I264V	probably benign	Het
Vmn2r94	T	A	17: 18,256,227	I403F	possibly damaging	Het
Zzef1	G	A	11: 72,855,482	R870Q	possibly damaging	Het

Other mutations in Sptb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Sptb	APN	12	76621331	missense	probably benign	0.00
IGL00160:Sptb	APN	12	76623169	missense	probably damaging	1.00
IGL00229:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL00820:Sptb	APN	12	76632477	missense	probably damaging	1.00
IGL01309:Sptb	APN	12	76587463	missense	probably benign	0.16
IGL01408:Sptb	APN	12	76613147	missense	possibly damaging	0.93
IGL01450:Sptb	APN	12	76624240	missense	possibly damaging	0.89
IGL01455:Sptb	APN	12	76612912	missense	probably damaging	1.00
IGL01457:Sptb	APN	12	76612555	splice site	probably benign
IGL01680:Sptb	APN	12	76630682	missense	probably damaging	1.00
IGL02070:Sptb	APN	12	76605539	missense	possibly damaging	0.82
IGL02346:Sptb	APN	12	76621014	missense	probably damaging	1.00
IGL02452:Sptb	APN	12	76609036	critical splice donor site	probably null
IGL02515:Sptb	APN	12	76606487	missense	possibly damaging	0.51
IGL02545:Sptb	APN	12	76607980	critical splice donor site	probably null
IGL02644:Sptb	APN	12	76605617	missense	probably damaging	1.00
IGL02878:Sptb	APN	12	76620753	missense	probably benign	0.20
IGL03007:Sptb	APN	12	76621341	missense	probably damaging	1.00
IGL03220:Sptb	APN	12	76612910	missense	probably benign	0.06
IGL03343:Sptb	APN	12	76583556	unclassified	probably benign
IGL03098:Sptb	UTSW	12	76621499	missense	probably damaging	1.00
PIT4472001:Sptb	UTSW	12	76620686	missense	probably damaging	1.00
R0047:Sptb	UTSW	12	76622950	missense	probably damaging	0.99
R0365:Sptb	UTSW	12	76600383	missense	probably benign	0.12
R0373:Sptb	UTSW	12	76621371	missense	probably benign	0.03
R0704:Sptb	UTSW	12	76583594	missense	probably damaging	0.99
R1005:Sptb	UTSW	12	76601859	critical splice donor site	probably null
R1109:Sptb	UTSW	12	76603603	missense	probably damaging	1.00
R1264:Sptb	UTSW	12	76612607	missense	probably damaging	1.00
R1358:Sptb	UTSW	12	76621321	frame shift	probably null
R1358:Sptb	UTSW	12	76621326	missense	probably damaging	1.00
R1459:Sptb	UTSW	12	76611883	missense	probably benign	0.01
R1518:Sptb	UTSW	12	76604024	missense	possibly damaging	0.95
R1628:Sptb	UTSW	12	76583848	missense	probably damaging	1.00
R1668:Sptb	UTSW	12	76621169	missense	probably benign
R1677:Sptb	UTSW	12	76629649	missense	probably damaging	1.00
R1687:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R1695:Sptb	UTSW	12	76620867	missense	probably benign	0.10
R1708:Sptb	UTSW	12	76612574	missense	probably damaging	1.00
R1761:Sptb	UTSW	12	76612608	missense	probably damaging	0.96
R1925:Sptb	UTSW	12	76622253	missense	probably damaging	1.00
R2011:Sptb	UTSW	12	76632472	missense	possibly damaging	0.95
R2373:Sptb	UTSW	12	76621161	missense	probably damaging	1.00
R2517:Sptb	UTSW	12	76649869	missense	possibly damaging	0.55
R2918:Sptb	UTSW	12	76598758	missense	probably damaging	0.97
R2961:Sptb	UTSW	12	76603582	missense	probably benign	0.19
R3409:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3410:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3411:Sptb	UTSW	12	76610815	missense	possibly damaging	0.78
R3744:Sptb	UTSW	12	76600400	missense	probably benign
R4112:Sptb	UTSW	12	76597779	missense	probably damaging	0.99
R4177:Sptb	UTSW	12	76613179	missense	probably benign	0.25
R4194:Sptb	UTSW	12	76613010	missense	probably benign	0.44
R4301:Sptb	UTSW	12	76612697	missense	probably damaging	1.00
R4555:Sptb	UTSW	12	76612851	missense	probably benign	0.03
R4619:Sptb	UTSW	12	76583807	nonsense	probably null
R4620:Sptb	UTSW	12	76583807	nonsense	probably null
R4625:Sptb	UTSW	12	76587326	splice site	probably null
R4728:Sptb	UTSW	12	76583379	missense	probably benign	0.00
R4751:Sptb	UTSW	12	76627110	missense	probably benign	0.07
R4810:Sptb	UTSW	12	76623197	nonsense	probably null
R4888:Sptb	UTSW	12	76609037	missense	probably benign	0.00
R4894:Sptb	UTSW	12	76624994	critical splice donor site	probably null
R5114:Sptb	UTSW	12	76609278	missense	probably damaging	1.00
R5191:Sptb	UTSW	12	76612834	missense	probably benign	0.12
R5479:Sptb	UTSW	12	76599851	missense	probably benign	0.04
R5646:Sptb	UTSW	12	76587441	missense	probably benign
R5727:Sptb	UTSW	12	76623114	missense	probably benign	0.25
R5797:Sptb	UTSW	12	76603699	missense	possibly damaging	0.95
R5874:Sptb	UTSW	12	76598727	missense	possibly damaging	0.91
R5952:Sptb	UTSW	12	76632384	missense	probably benign	0.02
R5956:Sptb	UTSW	12	76604168	missense	probably benign
R6298:Sptb	UTSW	12	76620654	critical splice donor site	probably null
R6470:Sptb	UTSW	12	76612829	missense	probably damaging	1.00
R6477:Sptb	UTSW	12	76606392	missense	probably damaging	1.00
R6736:Sptb	UTSW	12	76613180	missense	possibly damaging	0.49
R6854:Sptb	UTSW	12	76603480	missense	probably damaging	1.00
R6969:Sptb	UTSW	12	76608007	missense	probably damaging	1.00
R6987:Sptb	UTSW	12	76613247	missense	probably benign	0.00
R7023:Sptb	UTSW	12	76625088	missense	probably damaging	1.00
R7366:Sptb	UTSW	12	76604194	missense	probably damaging	1.00
R7379:Sptb	UTSW	12	76610877	missense	probably damaging	1.00
R7389:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7392:Sptb	UTSW	12	76624229	missense	probably damaging	0.98
R7477:Sptb	UTSW	12	76628565	missense	probably damaging	1.00
R7653:Sptb	UTSW	12	76628497	missense	probably benign	0.06
R7684:Sptb	UTSW	12	76612195	missense	probably benign	0.06
R7733:Sptb	UTSW	12	76597921	intron	probably null
R7846:Sptb	UTSW	12	76608526	nonsense	probably null
R7929:Sptb	UTSW	12	76608526	nonsense	probably null
R8048:Sptb	UTSW	12	76628559	missense	probably benign	0.02
X0057:Sptb	UTSW	12	76630739	missense	probably benign
Z1176:Sptb	UTSW	12	76620733	nonsense	probably null
Z1177:Sptb	UTSW	12	76583584	missense	probably damaging	1.00
Z1177:Sptb	UTSW	12	76606445	missense	probably benign	0.22

Predicted Primers

PCR Primer
(F):5'- TCATCCATCCAATCGATGCTG -3'
(R):5'- TTTCCCGTGTGACAGCTCTG -3'

Sequencing Primer
(F):5'- ATCCAATCGATGCTGTGCAG -3'
(R):5'- TGTGACAGCTCTGCCTGAG -3'

Posted On

2017-01-03