Incidental Mutation 'R5726:Zbtb18'
ID452470
Institutional Source Beutler Lab
Gene Symbol Zbtb18
Ensembl Gene ENSMUSG00000063659
Gene Namezinc finger and BTB domain containing 18
SynonymsRP58, Zfp238
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location177442351-177450764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 177448553 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 484 (H484R)
Ref Sequence ENSEMBL: ENSMUSP00000141724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077225] [ENSMUST00000094276] [ENSMUST00000192699] [ENSMUST00000192851] [ENSMUST00000193440] [ENSMUST00000193480] [ENSMUST00000194319] [ENSMUST00000195002] [ENSMUST00000195388] [ENSMUST00000195549] [ENSMUST00000195612]
Predicted Effect probably damaging
Transcript: ENSMUST00000077225
AA Change: H484R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076463
Gene: ENSMUSG00000063659
AA Change: H484R

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094276
AA Change: H493R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000091831
Gene: ENSMUSG00000063659
AA Change: H493R

DomainStartEndE-ValueType
BTB 33 130 2.55e-22 SMART
ZnF_C2H2 379 401 1.28e-3 SMART
ZnF_C2H2 419 441 1.01e-1 SMART
ZnF_C2H2 447 469 9.58e-3 SMART
ZnF_C2H2 475 498 1.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192699
Predicted Effect probably benign
Transcript: ENSMUST00000192851
SMART Domains Protein: ENSMUSP00000142256
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193440
SMART Domains Protein: ENSMUSP00000141337
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000193480
SMART Domains Protein: ENSMUSP00000141663
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 33 130 1.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194269
Predicted Effect probably benign
Transcript: ENSMUST00000194319
Predicted Effect probably benign
Transcript: ENSMUST00000195002
Predicted Effect probably benign
Transcript: ENSMUST00000195388
SMART Domains Protein: ENSMUSP00000141694
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195549
SMART Domains Protein: ENSMUSP00000142073
Gene: ENSMUSG00000063659

DomainStartEndE-ValueType
BTB 24 121 1.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000195612
AA Change: H484R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141724
Gene: ENSMUSG00000063659
AA Change: H484R

DomainStartEndE-ValueType
BTB 24 121 2.55e-22 SMART
ZnF_C2H2 370 392 1.28e-3 SMART
ZnF_C2H2 410 432 1.01e-1 SMART
ZnF_C2H2 438 460 9.58e-3 SMART
ZnF_C2H2 466 489 1.18e-2 SMART
Meta Mutation Damage Score 0.9590 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a C2H2-type zinc finger protein which acts a transcriptional repressor of genes involved in neuronal development. The encoded protein recognizes a specific sequence motif and recruits components of chromatin to target genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, cortical and hippocampal hypoplasia and laminar disorganization, and abnormal neuron apoptosis and cell cycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Zbtb18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Zbtb18 APN 1 177447983 missense probably benign 0.01
IGL01967:Zbtb18 APN 1 177447782 missense probably benign 0.25
PIT4434001:Zbtb18 UTSW 1 177448423 missense possibly damaging 0.93
R0085:Zbtb18 UTSW 1 177447935 missense probably benign 0.00
R0119:Zbtb18 UTSW 1 177448157 missense probably benign 0.05
R0309:Zbtb18 UTSW 1 177448616 missense probably damaging 0.99
R1614:Zbtb18 UTSW 1 177447170 missense probably damaging 1.00
R1660:Zbtb18 UTSW 1 177447763 missense probably benign 0.05
R1676:Zbtb18 UTSW 1 177447347 splice site probably null
R1750:Zbtb18 UTSW 1 177447511 missense possibly damaging 0.95
R2365:Zbtb18 UTSW 1 177448157 missense probably benign 0.05
R4282:Zbtb18 UTSW 1 177447479 missense probably damaging 1.00
R4497:Zbtb18 UTSW 1 177447121 missense probably damaging 1.00
R4542:Zbtb18 UTSW 1 177448666 missense probably damaging 0.99
R4678:Zbtb18 UTSW 1 177447719 missense probably benign 0.04
R5450:Zbtb18 UTSW 1 177447205 missense probably damaging 1.00
R5828:Zbtb18 UTSW 1 177447880 missense probably damaging 0.98
R5879:Zbtb18 UTSW 1 177448370 missense probably damaging 1.00
R6379:Zbtb18 UTSW 1 177447575 missense probably damaging 0.99
R6641:Zbtb18 UTSW 1 177448043 missense probably damaging 0.98
R7088:Zbtb18 UTSW 1 177447254 missense probably damaging 1.00
R7779:Zbtb18 UTSW 1 177446939 intron probably benign
R8255:Zbtb18 UTSW 1 177447437 missense probably damaging 1.00
R8868:Zbtb18 UTSW 1 177447116 missense probably benign 0.01
R8895:Zbtb18 UTSW 1 177448478 missense probably damaging 1.00
Z1177:Zbtb18 UTSW 1 177447815 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATGTACACCCTCAAGCG -3'
(R):5'- ACTGCTTTTAGACCGTACCACAAC -3'

Sequencing Primer
(F):5'- GCCACGAGAGGACTCACTC -3'
(R):5'- TTAGACCGTACCACAACTATATAGAG -3'
Posted On2017-01-03