Incidental Mutation 'R5726:Slc6a9'
ID452479
Institutional Source Beutler Lab
Gene Symbol Slc6a9
Ensembl Gene ENSMUSG00000028542
Gene Namesolute carrier family 6 (neurotransmitter transporter, glycine), member 9
SynonymsGlyt1, Glyt-1
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location117834506-117875198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117864013 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 208 (Y208C)
Ref Sequence ENSEMBL: ENSMUSP00000127093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030269] [ENSMUST00000063857] [ENSMUST00000132043] [ENSMUST00000149168] [ENSMUST00000163288] [ENSMUST00000164853] [ENSMUST00000169885] [ENSMUST00000169990]
Predicted Effect probably damaging
Transcript: ENSMUST00000030269
AA Change: Y320C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030269
Gene: ENSMUSG00000028542
AA Change: Y320C

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063857
AA Change: Y320C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066102
Gene: ENSMUSG00000028542
AA Change: Y320C

DomainStartEndE-ValueType
Pfam:SNF 27 562 5.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132043
SMART Domains Protein: ENSMUSP00000122676
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 32 321 1.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149168
SMART Domains Protein: ENSMUSP00000129359
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
low complexity region 91 116 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154439
Predicted Effect probably damaging
Transcript: ENSMUST00000163288
AA Change: Y324C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127289
Gene: ENSMUSG00000028542
AA Change: Y324C

DomainStartEndE-ValueType
Pfam:SNF 46 566 2.1e-212 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164716
Predicted Effect probably benign
Transcript: ENSMUST00000164853
SMART Domains Protein: ENSMUSP00000132114
Gene: ENSMUSG00000078588

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
coiled coil region 133 158 N/A INTRINSIC
low complexity region 254 266 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169885
AA Change: Y208C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127093
Gene: ENSMUSG00000028542
AA Change: Y208C

DomainStartEndE-ValueType
Pfam:SNF 1 450 1.2e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169990
SMART Domains Protein: ENSMUSP00000127203
Gene: ENSMUSG00000028542

DomainStartEndE-ValueType
Pfam:SNF 84 373 2.3e-132 PFAM
Meta Mutation Damage Score 0.2311 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The amino acid glycine acts as an inhibitory neurotransmitter in the central nervous system. The protein encoded by this gene is one of two transporters that stop glycine signaling by removing it from the synaptic cleft. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygous null mice die shortly after birth exhibiting breathing and movement deficiencies. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Slc6a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Slc6a9 APN 4 117864617 missense probably damaging 1.00
IGL01728:Slc6a9 APN 4 117864605 missense probably damaging 1.00
IGL02111:Slc6a9 APN 4 117864013 missense probably benign 0.19
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R0051:Slc6a9 UTSW 4 117864859 missense probably damaging 1.00
R1170:Slc6a9 UTSW 4 117864806 missense possibly damaging 0.77
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R2872:Slc6a9 UTSW 4 117849381 start codon destroyed probably null 0.02
R3499:Slc6a9 UTSW 4 117856803 missense probably benign 0.01
R4744:Slc6a9 UTSW 4 117867895 missense probably benign 0.00
R4970:Slc6a9 UTSW 4 117856008 missense probably damaging 1.00
R5055:Slc6a9 UTSW 4 117868150 unclassified probably null
R5103:Slc6a9 UTSW 4 117868155 missense probably benign
R6836:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
R7030:Slc6a9 UTSW 4 117857436 missense possibly damaging 0.94
R7061:Slc6a9 UTSW 4 117868064 missense probably benign 0.40
R7278:Slc6a9 UTSW 4 117868106 missense probably benign 0.31
R7863:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R7946:Slc6a9 UTSW 4 117864010 missense probably damaging 1.00
R8036:Slc6a9 UTSW 4 117867886 missense possibly damaging 0.49
Z1176:Slc6a9 UTSW 4 117857366 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTACTACCTGACCCCACAATG -3'
(R):5'- GCCTTCTACTTTCACACTGGAG -3'

Sequencing Primer
(F):5'- ATCCTGGAGGCCAAGGTG -3'
(R):5'- TGGAGATACAAGATCCTCAAGACTTC -3'
Posted On2017-01-03