Incidental Mutation 'R5726:Phf14'
ID452485
Institutional Source Beutler Lab
Gene Symbol Phf14
Ensembl Gene ENSMUSG00000029629
Gene NamePHD finger protein 14
Synonyms5730446A07Rik, 4932409F11Rik, 1110001C23Rik
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location11907809-12081205 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 11933538 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090632] [ENSMUST00000115510] [ENSMUST00000115511] [ENSMUST00000155037] [ENSMUST00000203459]
Predicted Effect unknown
Transcript: ENSMUST00000090632
AA Change: V133A
SMART Domains Protein: ENSMUSP00000088126
Gene: ENSMUSG00000029629
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115510
AA Change: V133A
SMART Domains Protein: ENSMUSP00000111172
Gene: ENSMUSG00000029629
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
low complexity region 830 848 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000115511
AA Change: V133A
SMART Domains Protein: ENSMUSP00000111173
Gene: ENSMUSG00000029629
AA Change: V133A

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
low complexity region 97 130 N/A INTRINSIC
low complexity region 131 166 N/A INTRINSIC
low complexity region 223 251 N/A INTRINSIC
PHD 314 371 1.64e-9 SMART
RING 315 381 1.21e1 SMART
PHD 433 492 1.18e-6 SMART
coiled coil region 620 671 N/A INTRINSIC
PHD 720 770 9.54e-11 SMART
RING 721 769 2.63e0 SMART
low complexity region 830 848 N/A INTRINSIC
PHD 863 912 9.92e-9 SMART
RING 864 911 3.17e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133776
SMART Domains Protein: ENSMUSP00000115485
Gene: ENSMUSG00000029629

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
PHD 40 97 1.64e-9 SMART
PHD 159 218 1.18e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155037
SMART Domains Protein: ENSMUSP00000144981
Gene: ENSMUSG00000029629

DomainStartEndE-ValueType
low complexity region 34 48 N/A INTRINSIC
coiled coil region 61 89 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203459
Meta Mutation Damage Score 0.0602 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete neonatal lethality due to respiratory failure, pulmonary wall hypertrophy, abnormal sternum ossification, and increased proliferation of bone marrow-derived mesenchymal cells and mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Phf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Phf14 APN 6 11941424 splice site probably benign
IGL01120:Phf14 APN 6 11962740 missense probably damaging 1.00
IGL01575:Phf14 APN 6 11990051 missense probably damaging 1.00
IGL02153:Phf14 APN 6 11934016 missense probably damaging 0.99
IGL02735:Phf14 APN 6 11987612 missense probably benign 0.21
IGL03294:Phf14 APN 6 11953367 missense probably damaging 1.00
IGL03392:Phf14 APN 6 11962659 missense probably damaging 1.00
R0060:Phf14 UTSW 6 11953317 missense probably damaging 0.97
R0099:Phf14 UTSW 6 11987697 unclassified probably benign
R0384:Phf14 UTSW 6 11997020 splice site probably benign
R0433:Phf14 UTSW 6 11933743 missense probably damaging 1.00
R0563:Phf14 UTSW 6 11933601 intron probably benign
R0590:Phf14 UTSW 6 11961578 missense possibly damaging 0.72
R1066:Phf14 UTSW 6 11987255 missense possibly damaging 0.47
R1187:Phf14 UTSW 6 11941496 missense probably damaging 0.97
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1469:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R1491:Phf14 UTSW 6 11941479 missense possibly damaging 0.80
R1543:Phf14 UTSW 6 11987683 critical splice donor site probably null
R1595:Phf14 UTSW 6 11988753 missense possibly damaging 0.69
R1861:Phf14 UTSW 6 11987611 missense probably benign 0.00
R2289:Phf14 UTSW 6 12047846 missense probably damaging 1.00
R2437:Phf14 UTSW 6 11962658 missense probably damaging 1.00
R3831:Phf14 UTSW 6 11933874 unclassified probably null
R3832:Phf14 UTSW 6 11933874 unclassified probably null
R3833:Phf14 UTSW 6 11933874 unclassified probably null
R4290:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4293:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4294:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4295:Phf14 UTSW 6 11987097 missense probably damaging 1.00
R4572:Phf14 UTSW 6 12006824 missense probably damaging 1.00
R4663:Phf14 UTSW 6 11953422 missense possibly damaging 0.92
R4673:Phf14 UTSW 6 11992057 missense probably damaging 1.00
R4882:Phf14 UTSW 6 11988757 missense possibly damaging 0.88
R4954:Phf14 UTSW 6 11987620 missense probably benign 0.09
R5148:Phf14 UTSW 6 11961642 missense possibly damaging 0.72
R5284:Phf14 UTSW 6 11997120 missense probably damaging 0.99
R5569:Phf14 UTSW 6 11934016 missense probably damaging 0.99
R5694:Phf14 UTSW 6 11990125 missense possibly damaging 0.68
R5730:Phf14 UTSW 6 11953320 missense possibly damaging 0.54
R5819:Phf14 UTSW 6 11997252 intron probably null
R5915:Phf14 UTSW 6 11933727 missense possibly damaging 0.66
R6578:Phf14 UTSW 6 11991997 missense probably damaging 1.00
R6950:Phf14 UTSW 6 12006855 missense probably damaging 1.00
R7181:Phf14 UTSW 6 11933341 missense unknown
R7352:Phf14 UTSW 6 11961638 missense probably damaging 1.00
R7355:Phf14 UTSW 6 12081007 missense probably benign 0.01
R8110:Phf14 UTSW 6 11953423 missense possibly damaging 0.91
X0025:Phf14 UTSW 6 11926813 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTGGAGAAGGTTCCTG -3'
(R):5'- GCATTGAGTTCTTCCATGGATAC -3'

Sequencing Primer
(F):5'- GTTCCTGTAGTGATTCTGAGGAAAAC -3'
(R):5'- GGATACAAAGTCCAACAGGGG -3'
Posted On2017-01-03