Mutagenetix > Incidental Mutation

Incidental Mutation 'R5726:Cspg4'

452494

Institutional Source

Beutler Lab

Gene Symbol

Cspg4

Ensembl Gene

ENSMUSG00000032911

Gene Name

chondroitin sulfate proteoglycan 4

Synonyms

AN2, 4732461B14Rik, NG2

MMRRC Submission

043344-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5726 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56865033-56899870 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 56885904 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 308 (T308S)

Ref Sequence

ENSEMBL: ENSMUSP00000038909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035661]

AlphaFold

Q8VHY0

Predicted Effect

probably damaging
Transcript: ENSMUST00000035661
AA Change: T308S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: T308S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
LamG	47	179	9.16e-22	SMART
LamG	223	364	3.52e-23	SMART
low complexity region	384	397	N/A	INTRINSIC
Pfam:Cadherin_3	495	646	1e-36	PFAM
Pfam:Cadherin_3	732	885	7.9e-14	PFAM
Pfam:Cadherin_3	868	996	7e-15	PFAM
Pfam:Cadherin_3	972	1115	9e-26	PFAM
Pfam:Cadherin_3	1116	1223	1.1e-10	PFAM
Pfam:Cadherin_3	1225	1344	3.3e-12	PFAM
Pfam:Cadherin_3	1425	1568	6.3e-52	PFAM
Pfam:Cadherin_3	1578	1684	9.7e-9	PFAM
Pfam:Cadherin_3	1674	1809	3.2e-9	PFAM
Pfam:Cadherin_3	1779	1929	1.6e-31	PFAM
transmembrane domain	2229	2251	N/A	INTRINSIC
low complexity region	2295	2305	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214057

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000215666

Meta Mutation Damage Score

0.4880

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	T	C	7: 128,236,660	K254E	probably damaging	Het
Aak1	C	T	6: 86,925,124	Q92*	probably null	Het
Acss3	T	C	10: 107,123,322	T88A	possibly damaging	Het
Adcy4	A	T	14: 55,783,661	S6R	probably damaging	Het
Aldh1l2	T	C	10: 83,512,306	E311G	possibly damaging	Het
Arhgap25	C	T	6: 87,463,459	S402N	probably benign	Het
Btn1a1	T	A	13: 23,459,352	D309V	probably damaging	Het
Cdh23	C	T	10: 60,407,480	V1037M	probably damaging	Het
Clcn2	T	C	16: 20,710,535		probably benign	Het
Cln3	T	C	7: 126,575,501	T276A	probably null	Het
CN725425	A	G	15: 91,260,503	E523G	possibly damaging	Het
Dgkh	G	T	14: 78,624,902	F208L	probably benign	Het
Eif2ak4	A	G	2: 118,443,132	D846G	probably damaging	Het
Fmo4	A	G	1: 162,808,259		probably null	Het
Foxp4	A	G	17: 47,869,108	Y623H	unknown	Het
Fxr2	T	C	11: 69,633,346	V10A	probably benign	Het
Gm10271	T	C	10: 116,956,887		probably null	Het
Gsk3b	T	C	16: 38,208,136		probably benign	Het
Ift43	T	A	12: 86,162,183	D169E	probably damaging	Het
Ift57	T	A	16: 49,699,498	L54H	probably damaging	Het
Ighv1-37	T	C	12: 114,896,674		probably benign	Het
Ispd	T	C	12: 36,547,830	V320A	probably damaging	Het
Kl	A	G	5: 150,991,538	N910S	possibly damaging	Het
Lrp2	T	C	2: 69,509,147	D1140G	probably damaging	Het
Map1a	G	A	2: 121,305,065	A1883T	probably damaging	Het
Map4k2	G	T	19: 6,351,332	G611C	probably damaging	Het
Mical1	A	G	10: 41,483,696		probably benign	Het
Myh14	A	G	7: 44,643,462		probably null	Het
Myh8	T	A	11: 67,294,566	V881D	possibly damaging	Het
Myo1g	G	T	11: 6,509,420	Q817K	probably benign	Het
Nin	A	C	12: 70,078,179	V123G	probably damaging	Het
Nup160	A	G	2: 90,717,851	D976G	probably damaging	Het
Nup210l	A	T	3: 90,129,207		probably null	Het
Olfr262	A	G	19: 12,241,280	I127T	probably damaging	Het
Phf14	T	C	6: 11,933,538		probably benign	Het
Podxl2	T	C	6: 88,848,739	D400G	probably damaging	Het
Pygl	C	T	12: 70,191,142	W707*	probably null	Het
Rnf19b	T	C	4: 129,071,892	V261A	possibly damaging	Het
Rnf213	A	G	11: 119,416,458	Y648C	probably damaging	Het
Scn5a	C	T	9: 119,533,847	R569H	probably damaging	Het
Sdk2	A	G	11: 113,851,800	L761P	probably damaging	Het
Shroom3	C	T	5: 92,943,005	P1124S	probably benign	Het
Sirt4	A	G	5: 115,479,646	V317A	probably benign	Het
Slc12a2	G	T	18: 57,896,354	A271S	probably benign	Het
Slc6a9	A	G	4: 117,864,013	Y208C	probably damaging	Het
Snap23	T	A	2: 120,584,271		probably benign	Het
Sra1	C	T	18: 36,670,173		probably benign	Het
Srbd1	C	T	17: 86,120,729	D359N	possibly damaging	Het
Srp19	A	G	18: 34,331,773	Y22C	probably damaging	Het
Sstr4	T	C	2: 148,396,083	S205P	probably damaging	Het
Sv2b	T	C	7: 75,124,214	D503G	possibly damaging	Het
Tbc1d30	C	T	10: 121,267,574	V518M	probably damaging	Het
Tlr4	A	G	4: 66,840,415	K482E	probably benign	Het
Tpm1	G	A	9: 67,023,412	L310F	probably damaging	Het
Trpm6	A	G	19: 18,853,617	Y1282C	probably damaging	Het
Tsc22d1	T	A	14: 76,505,317	L65*	probably null	Het
Ttc37	T	C	13: 76,118,347	Y238H	probably damaging	Het
Ttc39c	C	A	18: 12,697,935	A284D	probably damaging	Het
Txndc16	G	A	14: 45,165,764	H297Y	probably benign	Het
Utrn	A	T	10: 12,669,806	D1698E	probably benign	Het
Vmn1r232	C	T	17: 20,913,339	R333H	probably benign	Het
Vmn2r14	A	T	5: 109,217,620	D529E	possibly damaging	Het
Vmn2r70	C	T	7: 85,559,107	V721I	probably damaging	Het
Zbtb18	A	G	1: 177,448,553	H484R	probably damaging	Het
Zc3h13	T	A	14: 75,330,829	S1187R	possibly damaging	Het
Zfhx4	T	A	3: 5,403,321	D2846E	probably benign	Het

Other mutations in Cspg4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01074:Cspg4	APN	9	56898865	missense	probably damaging	1.00
IGL01322:Cspg4	APN	9	56898588	missense	probably damaging	1.00
IGL01922:Cspg4	APN	9	56887887	missense	probably damaging	1.00
IGL01993:Cspg4	APN	9	56898478	missense	probably benign	0.09
IGL02379:Cspg4	APN	9	56892609	splice site	probably benign
IGL02398:Cspg4	APN	9	56886686	missense	probably benign	0.43
IGL02503:Cspg4	APN	9	56897403	missense	probably damaging	1.00
IGL02504:Cspg4	APN	9	56885772	missense	probably benign	0.06
IGL02692:Cspg4	APN	9	56887454	missense	probably benign	0.00
IGL02728:Cspg4	APN	9	56886481	missense	probably damaging	1.00
IGL02806:Cspg4	APN	9	56890259	missense	possibly damaging	0.57
IGL02886:Cspg4	APN	9	56897388	missense	probably damaging	0.99
IGL03005:Cspg4	APN	9	56888488	missense	probably damaging	1.00
IGL03008:Cspg4	APN	9	56898475	missense	possibly damaging	0.48
IGL03202:Cspg4	APN	9	56897739	missense	possibly damaging	0.93
chiclets	UTSW	9	56885222	splice site	probably null
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0066:Cspg4	UTSW	9	56888134	missense	probably damaging	1.00
R0254:Cspg4	UTSW	9	56897410	missense	probably damaging	0.98
R0284:Cspg4	UTSW	9	56886139	missense	probably damaging	0.96
R0513:Cspg4	UTSW	9	56898091	missense	probably benign	0.03
R0602:Cspg4	UTSW	9	56888017	missense	probably damaging	1.00
R0747:Cspg4	UTSW	9	56890280	missense	probably damaging	1.00
R1005:Cspg4	UTSW	9	56888736	missense	probably benign	0.13
R1421:Cspg4	UTSW	9	56896626	missense	probably benign	0.00
R1443:Cspg4	UTSW	9	56886512	missense	probably damaging	1.00
R1481:Cspg4	UTSW	9	56887810	missense	probably damaging	0.98
R1585:Cspg4	UTSW	9	56898867	missense	probably damaging	0.99
R1624:Cspg4	UTSW	9	56888470	missense	probably damaging	1.00
R1670:Cspg4	UTSW	9	56897403	missense	probably damaging	1.00
R1721:Cspg4	UTSW	9	56888743	missense	probably damaging	0.98
R1728:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1729:Cspg4	UTSW	9	56898537	missense	probably benign	0.00
R1763:Cspg4	UTSW	9	56886979	missense	probably damaging	0.97
R1772:Cspg4	UTSW	9	56897492	missense	probably benign	0.02
R1938:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R1975:Cspg4	UTSW	9	56890478	missense	probably damaging	1.00
R2064:Cspg4	UTSW	9	56896656	missense	probably damaging	1.00
R2185:Cspg4	UTSW	9	56886972	missense	probably benign	0.37
R2252:Cspg4	UTSW	9	56898046	missense	probably damaging	1.00
R2291:Cspg4	UTSW	9	56892743	missense	probably damaging	0.96
R2329:Cspg4	UTSW	9	56888550	missense	probably benign	0.00
R3780:Cspg4	UTSW	9	56888233	missense	probably damaging	1.00
R3830:Cspg4	UTSW	9	56897621	missense	probably damaging	0.99
R3944:Cspg4	UTSW	9	56886123	missense	probably damaging	1.00
R4011:Cspg4	UTSW	9	56887317	missense	probably benign	0.19
R4115:Cspg4	UTSW	9	56898394	missense	probably damaging	1.00
R4173:Cspg4	UTSW	9	56887930	missense	probably damaging	1.00
R4243:Cspg4	UTSW	9	56887857	missense	probably benign	0.12
R4329:Cspg4	UTSW	9	56892465	missense	probably damaging	0.99
R4544:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4545:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4546:Cspg4	UTSW	9	56888629	missense	possibly damaging	0.79
R4649:Cspg4	UTSW	9	56886865	missense	possibly damaging	0.93
R4663:Cspg4	UTSW	9	56886676	missense	possibly damaging	0.61
R4674:Cspg4	UTSW	9	56898205	missense	probably damaging	1.00
R4779:Cspg4	UTSW	9	56885808	missense	probably damaging	1.00
R4884:Cspg4	UTSW	9	56898069	missense	probably benign	0.00
R5021:Cspg4	UTSW	9	56897730	missense	probably benign	0.01
R5051:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
R5328:Cspg4	UTSW	9	56885856	missense	probably benign	0.01
R5394:Cspg4	UTSW	9	56890200	missense	probably damaging	1.00
R5567:Cspg4	UTSW	9	56886648	missense	probably benign	0.00
R5682:Cspg4	UTSW	9	56886196	missense	probably benign	0.14
R5690:Cspg4	UTSW	9	56898735	missense	probably benign	0.01
R5715:Cspg4	UTSW	9	56891051	missense	possibly damaging	0.90
R5717:Cspg4	UTSW	9	56885798	missense	probably benign
R5898:Cspg4	UTSW	9	56885222	splice site	probably null
R6140:Cspg4	UTSW	9	56897224	missense	probably benign	0.35
R6147:Cspg4	UTSW	9	56888772	missense	probably damaging	0.99
R6239:Cspg4	UTSW	9	56888182	missense	probably benign	0.04
R6343:Cspg4	UTSW	9	56892692	missense	probably benign
R6351:Cspg4	UTSW	9	56892644	missense	probably benign	0.00
R6564:Cspg4	UTSW	9	56890158	missense	probably benign	0.02
R6814:Cspg4	UTSW	9	56890340	missense	possibly damaging	0.91
R6928:Cspg4	UTSW	9	56897880	missense	possibly damaging	0.95
R6967:Cspg4	UTSW	9	56890136	missense	possibly damaging	0.52
R6981:Cspg4	UTSW	9	56887101	missense	probably benign	0.00
R7033:Cspg4	UTSW	9	56888074	missense	probably damaging	0.96
R7419:Cspg4	UTSW	9	56888443	missense	possibly damaging	0.94
R7809:Cspg4	UTSW	9	56890190	missense	probably damaging	1.00
R7940:Cspg4	UTSW	9	56888097	nonsense	probably null
R8078:Cspg4	UTSW	9	56890259	missense	possibly damaging	0.57
R8082:Cspg4	UTSW	9	56885893	missense	probably damaging	1.00
R8217:Cspg4	UTSW	9	56890353	missense	possibly damaging	0.53
R8237:Cspg4	UTSW	9	56892680	missense	probably damaging	1.00
R8353:Cspg4	UTSW	9	56898669	missense	probably damaging	1.00
R8372:Cspg4	UTSW	9	56887195	missense	probably damaging	1.00
R8691:Cspg4	UTSW	9	56892996	missense	probably benign
R8720:Cspg4	UTSW	9	56887513	missense	probably benign	0.25
R8907:Cspg4	UTSW	9	56883683	missense	probably damaging	1.00
R9063:Cspg4	UTSW	9	56888403	missense	probably benign	0.03
R9115:Cspg4	UTSW	9	56890452	missense	probably damaging	1.00
R9152:Cspg4	UTSW	9	56888179	missense	probably benign	0.26
R9154:Cspg4	UTSW	9	56891003	missense
R9361:Cspg4	UTSW	9	56896593	missense	probably damaging	1.00
R9574:Cspg4	UTSW	9	56890058	missense	probably damaging	1.00
R9608:Cspg4	UTSW	9	56885552	missense	probably benign
R9685:Cspg4	UTSW	9	56890338	missense	probably benign	0.05
X0065:Cspg4	UTSW	9	56885736	missense	possibly damaging	0.95
Z1088:Cspg4	UTSW	9	56886036	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGTGGCAACTTTATCTACGTG -3'
(R):5'- CATCCTGCTGACATGTCACG -3'

Sequencing Primer
(F):5'- TACGTGGACATATTTGAGGGCCAC -3'
(R):5'- TGCTGACATGTCACGGGTCAG -3'

Posted On

2017-01-03