Incidental Mutation 'R5726:Tpm1'
ID452495
Institutional Source Beutler Lab
Gene Symbol Tpm1
Ensembl Gene ENSMUSG00000032366
Gene Nametropomyosin 1, alpha
SynonymsTM2, Tpm-1, alpha-TM, Tm3
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5726 (G1)
Quality Score144
Status Validated
Chromosome9
Chromosomal Location67022590-67049406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67023412 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 310 (L310F)
Ref Sequence ENSEMBL: ENSMUSP00000034928 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034928] [ENSMUST00000050905] [ENSMUST00000113684] [ENSMUST00000113685] [ENSMUST00000113686] [ENSMUST00000113687] [ENSMUST00000113689] [ENSMUST00000113690] [ENSMUST00000113693] [ENSMUST00000113695] [ENSMUST00000113696] [ENSMUST00000113697] [ENSMUST00000113701] [ENSMUST00000113705] [ENSMUST00000113707] [ENSMUST00000129733] [ENSMUST00000139046]
Predicted Effect probably damaging
Transcript: ENSMUST00000034928
AA Change: L310F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034928
Gene: ENSMUSG00000032366
AA Change: L310F

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:Tropomyosin_1 56 195 4.1e-29 PFAM
Pfam:Tropomyosin 90 326 5.9e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050905
SMART Domains Protein: ENSMUSP00000051888
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 5.1e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113684
SMART Domains Protein: ENSMUSP00000109314
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 248 8.1e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113685
SMART Domains Protein: ENSMUSP00000109315
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 3.1e-102 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113686
SMART Domains Protein: ENSMUSP00000109316
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 2.9e-23 PFAM
Pfam:Tropomyosin 12 228 8.4e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113687
SMART Domains Protein: ENSMUSP00000109317
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 7.4e-40 PFAM
Pfam:Tropomyosin 48 264 1.8e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113689
SMART Domains Protein: ENSMUSP00000109319
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 3 117 1.4e-22 PFAM
Pfam:Tropomyosin 12 244 8.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113690
SMART Domains Protein: ENSMUSP00000109320
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 5.9e-23 PFAM
Pfam:Tropomyosin 12 244 8.3e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113693
SMART Domains Protein: ENSMUSP00000109323
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 6.1e-37 PFAM
Pfam:Tropomyosin 48 280 8.6e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113695
AA Change: L232F

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109325
Gene: ENSMUSG00000032366
AA Change: L232F

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 1.5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113696
AA Change: L232F

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109326
Gene: ENSMUSG00000032366
AA Change: L232F

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 4 117 6.1e-23 PFAM
Pfam:Tropomyosin 12 248 2.5e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113697
AA Change: L268F

PolyPhen 2 Score 0.664 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109327
Gene: ENSMUSG00000032366
AA Change: L268F

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 1.1e-94 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113701
AA Change: L268F

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109331
Gene: ENSMUSG00000032366
AA Change: L268F

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 1.6e-90 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113705
AA Change: L268F

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109335
Gene: ENSMUSG00000032366
AA Change: L268F

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 1.9e-31 PFAM
Pfam:Tropomyosin 48 284 9.5e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113707
AA Change: L268F

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109337
Gene: ENSMUSG00000032366
AA Change: L268F

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 2.2e-39 PFAM
Pfam:Tropomyosin 48 284 6.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129733
SMART Domains Protein: ENSMUSP00000138784
Gene: ENSMUSG00000032366

DomainStartEndE-ValueType
Pfam:Tropomyosin_1 7 153 4e-36 PFAM
Pfam:Tropomyosin 48 128 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139046
Meta Mutation Damage Score 0.1189 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Tpm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01288:Tpm1 APN 9 67036055 missense probably damaging 1.00
IGL01569:Tpm1 APN 9 67031108 splice site probably null
R1137:Tpm1 UTSW 9 67031118 intron probably null
R1554:Tpm1 UTSW 9 67023429 missense probably benign 0.04
R2012:Tpm1 UTSW 9 67033965 nonsense probably null
R2898:Tpm1 UTSW 9 67031040 missense probably damaging 1.00
R3723:Tpm1 UTSW 9 67031945 intron probably benign
R3724:Tpm1 UTSW 9 67031945 intron probably benign
R4172:Tpm1 UTSW 9 67023367 missense probably benign 0.34
R4427:Tpm1 UTSW 9 67032565 intron probably benign
R4934:Tpm1 UTSW 9 67028049 splice site probably null
R5605:Tpm1 UTSW 9 67049035 missense probably damaging 0.99
R6556:Tpm1 UTSW 9 67028169 critical splice acceptor site probably null
R6910:Tpm1 UTSW 9 67031974 missense probably damaging 1.00
R7242:Tpm1 UTSW 9 67028101 missense probably benign
R7386:Tpm1 UTSW 9 67028167 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGATGTTTCAGTGACAGTGG -3'
(R):5'- TGCACTTTACGTCAGGGTGG -3'

Sequencing Primer
(F):5'- TGTTTCAGTGACAGTGGTAAAAG -3'
(R):5'- ACGTCAGGGTGGGTTGCAG -3'
Posted On2017-01-03