Incidental Mutation 'R0552:Inf2'
ID45250
Institutional Source Beutler Lab
Gene Symbol Inf2
Ensembl Gene ENSMUSG00000037679
Gene Nameinverted formin, FH2 and WH2 domain containing
Synonyms2610204M08Rik, EG629699
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location112588784-112615557 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 112612574 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000101029]
Predicted Effect unknown
Transcript: ENSMUST00000101029
AA Change: K1263E
SMART Domains Protein: ENSMUSP00000098591
Gene: ENSMUSG00000037679
AA Change: K1263E

DomainStartEndE-ValueType
Drf_GBD 1 152 3.47e-34 SMART
Drf_FH3 156 343 2.18e-58 SMART
low complexity region 359 382 N/A INTRINSIC
low complexity region 420 518 N/A INTRINSIC
low complexity region 525 557 N/A INTRINSIC
FH2 587 1030 1.96e-53 SMART
WH2 1005 1020 1.68e-2 SMART
Blast:FH2 1049 1179 3e-28 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000222275
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene represents a member of the formin family of proteins. It is considered a diaphanous formin due to the presence of a diaphanous inhibitory domain located at the N-terminus of the encoded protein. Studies of a similar mouse protein indicate that the protein encoded by this locus may function in polymerization and depolymerization of actin filaments. Mutations at this locus have been associated with focal segmental glomerulosclerosis 5.[provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele display placental vasculopathy, restricted fetal growth, increased gestational length and transient increase in maternal blood pressure in the late stages of pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Inf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Inf2 APN 12 112611856 nonsense probably null
IGL01582:Inf2 APN 12 112610559 missense unknown
IGL02078:Inf2 APN 12 112601614 missense probably damaging 1.00
IGL02534:Inf2 APN 12 112610496 missense unknown
IGL03122:Inf2 APN 12 112604229 missense probably benign 0.03
IGL03296:Inf2 APN 12 112604208 nonsense probably null
Talon UTSW 12 112610287 splice site probably benign
R0413:Inf2 UTSW 12 112601676 missense probably damaging 1.00
R0920:Inf2 UTSW 12 112610287 splice site probably benign
R1240:Inf2 UTSW 12 112610776 missense unknown
R1452:Inf2 UTSW 12 112601344 missense probably damaging 0.99
R1974:Inf2 UTSW 12 112608337 missense unknown
R2422:Inf2 UTSW 12 112610824 missense unknown
R3877:Inf2 UTSW 12 112610830 missense unknown
R4108:Inf2 UTSW 12 112607581 missense unknown
R4490:Inf2 UTSW 12 112600204 missense probably damaging 1.00
R5071:Inf2 UTSW 12 112612039 splice site probably null
R5074:Inf2 UTSW 12 112612039 splice site probably null
R5306:Inf2 UTSW 12 112601553 missense probably benign 0.26
R5383:Inf2 UTSW 12 112600145 missense probably damaging 0.99
R5569:Inf2 UTSW 12 112601679 missense possibly damaging 0.80
R5664:Inf2 UTSW 12 112611728 missense unknown
R6157:Inf2 UTSW 12 112604788 unclassified probably benign
R6221:Inf2 UTSW 12 112603745 missense possibly damaging 0.66
R6429:Inf2 UTSW 12 112604256 missense probably benign 0.01
R6955:Inf2 UTSW 12 112610731 missense unknown
R7423:Inf2 UTSW 12 112609738 missense unknown
R7444:Inf2 UTSW 12 112605387 missense unknown
R7496:Inf2 UTSW 12 112600318 missense probably damaging 1.00
R7605:Inf2 UTSW 12 112601337 missense probably damaging 1.00
R7678:Inf2 UTSW 12 112606994 missense unknown
R7708:Inf2 UTSW 12 112607557 missense unknown
R7752:Inf2 UTSW 12 112609684 missense unknown
R7903:Inf2 UTSW 12 112612554 missense unknown
R7986:Inf2 UTSW 12 112612554 missense unknown
R8024:Inf2 UTSW 12 112608902 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTCAGTGGGGCACAGCACTTC -3'
(R):5'- GCCTTCTCTAACAAGGCAGCACAG -3'

Sequencing Primer
(F):5'- GGTCTGACATTAAGTTCCTAATTGC -3'
(R):5'- GAGGCACCACCACCATGAG -3'
Posted On2013-06-11