Incidental Mutation 'R5726:Aldh1l2'
ID 452500
Institutional Source Beutler Lab
Gene Symbol Aldh1l2
Ensembl Gene ENSMUSG00000020256
Gene Name aldehyde dehydrogenase 1 family, member L2
Synonyms
MMRRC Submission 043344-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5726 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 83487450-83534140 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 83512306 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 311 (E311G)
Ref Sequence ENSEMBL: ENSMUSP00000117076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]
AlphaFold Q8K009
Predicted Effect possibly damaging
Transcript: ENSMUST00000020497
AA Change: E424G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: E424G

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 23 202 5e-46 PFAM
Pfam:Formyl_trans_C 226 330 1.3e-16 PFAM
Pfam:PP-binding 346 412 9.6e-7 PFAM
Pfam:Aldedh 451 919 3.4e-174 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143793
Predicted Effect possibly damaging
Transcript: ENSMUST00000146640
AA Change: E311G

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: E311G

DomainStartEndE-ValueType
Pfam:Formyl_trans_N 1 89 2.8e-30 PFAM
Pfam:Formyl_trans_C 113 217 1.1e-16 PFAM
Pfam:PP-binding 233 299 1.5e-8 PFAM
Pfam:Aldedh 338 806 8.5e-175 PFAM
Meta Mutation Damage Score 0.2701 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Aldh1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Aldh1l2 APN 10 83522886 nonsense probably null
IGL01154:Aldh1l2 APN 10 83520373 missense probably damaging 1.00
IGL01301:Aldh1l2 APN 10 83522846 missense probably damaging 1.00
IGL01354:Aldh1l2 APN 10 83527376 missense probably damaging 1.00
IGL01364:Aldh1l2 APN 10 83492667 missense probably damaging 1.00
IGL01445:Aldh1l2 APN 10 83520262 splice site probably benign
IGL02179:Aldh1l2 APN 10 83522837 missense probably benign 0.10
IGL02283:Aldh1l2 APN 10 83495895 missense probably benign 0.00
IGL02507:Aldh1l2 APN 10 83492584 nonsense probably null
IGL02727:Aldh1l2 APN 10 83506605 missense probably damaging 1.00
IGL03353:Aldh1l2 APN 10 83522913 missense probably benign 0.17
Hunger_winter UTSW 10 83508013 critical splice donor site probably null
Spartan UTSW 10 83512306 missense possibly damaging 0.93
ANU18:Aldh1l2 UTSW 10 83522846 missense probably damaging 1.00
IGL02984:Aldh1l2 UTSW 10 83527335 missense probably damaging 1.00
R0267:Aldh1l2 UTSW 10 83522687 splice site probably benign
R0302:Aldh1l2 UTSW 10 83520365 missense probably damaging 1.00
R0349:Aldh1l2 UTSW 10 83490614 missense probably damaging 1.00
R0468:Aldh1l2 UTSW 10 83518678 missense probably benign 0.01
R0745:Aldh1l2 UTSW 10 83518630 splice site probably null
R0788:Aldh1l2 UTSW 10 83516164 missense probably damaging 1.00
R1117:Aldh1l2 UTSW 10 83508623 missense probably benign 0.01
R1241:Aldh1l2 UTSW 10 83496025 missense probably benign 0.00
R1420:Aldh1l2 UTSW 10 83495935 missense probably damaging 1.00
R1490:Aldh1l2 UTSW 10 83520370 missense probably damaging 1.00
R1704:Aldh1l2 UTSW 10 83508660 missense probably benign 0.10
R1729:Aldh1l2 UTSW 10 83508082 nonsense probably null
R1893:Aldh1l2 UTSW 10 83492536 missense probably damaging 1.00
R1897:Aldh1l2 UTSW 10 83502525 missense probably damaging 1.00
R2047:Aldh1l2 UTSW 10 83506743 missense probably damaging 1.00
R2290:Aldh1l2 UTSW 10 83527313 missense probably damaging 1.00
R3054:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R3055:Aldh1l2 UTSW 10 83502472 missense probably benign 0.14
R4097:Aldh1l2 UTSW 10 83512364 missense probably damaging 0.98
R4162:Aldh1l2 UTSW 10 83506654 missense possibly damaging 0.50
R4295:Aldh1l2 UTSW 10 83495920 missense possibly damaging 0.62
R4296:Aldh1l2 UTSW 10 83522777 missense probably benign 0.34
R4388:Aldh1l2 UTSW 10 83513622 missense probably damaging 1.00
R4809:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R5052:Aldh1l2 UTSW 10 83508692 missense possibly damaging 0.92
R5421:Aldh1l2 UTSW 10 83527407 missense probably damaging 1.00
R5491:Aldh1l2 UTSW 10 83522785 missense probably benign 0.00
R5688:Aldh1l2 UTSW 10 83501925 missense possibly damaging 0.93
R5737:Aldh1l2 UTSW 10 83520325 missense probably damaging 1.00
R5752:Aldh1l2 UTSW 10 83520380 missense probably damaging 1.00
R6113:Aldh1l2 UTSW 10 83508134 nonsense probably null
R6161:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R6166:Aldh1l2 UTSW 10 83493424 splice site probably null
R6189:Aldh1l2 UTSW 10 83508013 critical splice donor site probably null
R7357:Aldh1l2 UTSW 10 83514544 missense possibly damaging 0.89
R7394:Aldh1l2 UTSW 10 83502457 missense probably damaging 1.00
R7469:Aldh1l2 UTSW 10 83508105 missense probably damaging 1.00
R7676:Aldh1l2 UTSW 10 83508111 missense probably benign
R7848:Aldh1l2 UTSW 10 83499843 missense probably benign 0.12
R7958:Aldh1l2 UTSW 10 83520338 missense probably benign 0.00
R8311:Aldh1l2 UTSW 10 83490615 missense probably damaging 1.00
R8477:Aldh1l2 UTSW 10 83501921 missense probably damaging 1.00
R8730:Aldh1l2 UTSW 10 83506642 missense possibly damaging 0.94
R8884:Aldh1l2 UTSW 10 83508677 missense probably benign 0.02
R9117:Aldh1l2 UTSW 10 83506681 missense probably benign 0.41
R9239:Aldh1l2 UTSW 10 83506632 missense probably damaging 1.00
R9335:Aldh1l2 UTSW 10 83506646 missense probably damaging 0.96
R9368:Aldh1l2 UTSW 10 83495952 nonsense probably null
R9784:Aldh1l2 UTSW 10 83506750 critical splice acceptor site probably null
Z1177:Aldh1l2 UTSW 10 83493480 missense probably damaging 1.00
Z1177:Aldh1l2 UTSW 10 83534005 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAGCTGTATACCTCTAAATTCAG -3'
(R):5'- ATGCCAGTGAACAGGCCATG -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- CAGTGAACAGGCCATGAGGAAAC -3'
Posted On 2017-01-03