Incidental Mutation 'R5726:Acss3'
ID452501
Institutional Source Beutler Lab
Gene Symbol Acss3
Ensembl Gene ENSMUSG00000035948
Gene Nameacyl-CoA synthetase short-chain family member 3
SynonymsLOC380660, 8430416H19Rik
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location106933517-107123668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107123322 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 88 (T88A)
Ref Sequence ENSEMBL: ENSMUSP00000128209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044668] [ENSMUST00000165067]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044668
AA Change: T88A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040823
Gene: ENSMUSG00000035948
AA Change: T88A

DomainStartEndE-ValueType
Pfam:AMP-binding 112 496 4.6e-67 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065567
Predicted Effect possibly damaging
Transcript: ENSMUST00000165067
AA Change: T88A

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128209
Gene: ENSMUSG00000035948
AA Change: T88A

DomainStartEndE-ValueType
Pfam:ACAS_N 57 111 8.8e-22 PFAM
Pfam:AMP-binding 113 557 3.2e-81 PFAM
Pfam:AMP-binding_C 565 644 2.2e-22 PFAM
Meta Mutation Damage Score 0.1187 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Acss3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Acss3 APN 10 106966026 missense probably benign
IGL00941:Acss3 APN 10 107053326 critical splice donor site probably null
IGL00983:Acss3 APN 10 106966964 nonsense probably null
IGL01010:Acss3 APN 10 107023849 splice site probably benign
IGL02227:Acss3 APN 10 107045335 missense probably benign
IGL02296:Acss3 APN 10 107053451 nonsense probably null
IGL02319:Acss3 APN 10 106948750 missense probably damaging 0.99
IGL03181:Acss3 APN 10 107053388 missense probably damaging 1.00
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0032:Acss3 UTSW 10 107123295 missense probably benign 0.13
R0279:Acss3 UTSW 10 107084871 missense possibly damaging 0.95
R0418:Acss3 UTSW 10 107023912 missense probably damaging 0.99
R0550:Acss3 UTSW 10 107053471 missense probably damaging 1.00
R1114:Acss3 UTSW 10 106988879 missense possibly damaging 0.89
R1491:Acss3 UTSW 10 106937308 missense probably benign
R1625:Acss3 UTSW 10 106937402 critical splice donor site probably null
R1771:Acss3 UTSW 10 106937200 missense probably damaging 1.00
R1956:Acss3 UTSW 10 106936168 missense probably benign 0.00
R2006:Acss3 UTSW 10 106963010 missense possibly damaging 0.81
R2018:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2019:Acss3 UTSW 10 106936207 missense probably benign 0.00
R2078:Acss3 UTSW 10 106967041 missense possibly damaging 0.94
R2253:Acss3 UTSW 10 107004748 missense probably damaging 1.00
R2391:Acss3 UTSW 10 107123487 missense probably benign 0.00
R3082:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R3083:Acss3 UTSW 10 107023715 missense possibly damaging 0.94
R4072:Acss3 UTSW 10 107123585 unclassified probably benign
R4086:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4087:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4089:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4090:Acss3 UTSW 10 107053452 missense probably damaging 1.00
R4406:Acss3 UTSW 10 107053337 missense probably damaging 1.00
R4607:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4608:Acss3 UTSW 10 106967029 missense possibly damaging 0.88
R4790:Acss3 UTSW 10 107023702 nonsense probably null
R4834:Acss3 UTSW 10 107084805 critical splice donor site probably null
R5130:Acss3 UTSW 10 107004725 missense possibly damaging 0.87
R5303:Acss3 UTSW 10 107084851 missense possibly damaging 0.74
R5365:Acss3 UTSW 10 107004728 missense probably damaging 1.00
R5439:Acss3 UTSW 10 106937147 nonsense probably null
R5617:Acss3 UTSW 10 106951990 missense probably damaging 1.00
R5698:Acss3 UTSW 10 106948744 missense probably damaging 1.00
R6154:Acss3 UTSW 10 107123349 missense probably benign 0.02
R6298:Acss3 UTSW 10 107084856 missense probably damaging 1.00
R6592:Acss3 UTSW 10 107023718 missense possibly damaging 0.94
R6707:Acss3 UTSW 10 107084922 missense probably damaging 1.00
R6999:Acss3 UTSW 10 107053501 missense probably damaging 1.00
R7567:Acss3 UTSW 10 107123313 missense probably benign 0.00
X0027:Acss3 UTSW 10 107123344 missense probably benign 0.05
Z1177:Acss3 UTSW 10 107004777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGCAAGTCAACCTCTGTGG -3'
(R):5'- TTCAGTAAGAGGAGCCGCTG -3'

Sequencing Primer
(F):5'- AAGTCAACCTCTGTGGCACTG -3'
(R):5'- TAAGAGGAGCCGCTGTGACC -3'
Posted On2017-01-03