Mutagenetix > Incidental Mutation

Incidental Mutation 'R5726:Rnf213'

452509

Institutional Source

Beutler Lab

Gene Symbol

Rnf213

Ensembl Gene

ENSMUSG00000070327

Gene Name

ring finger protein 213

Synonyms

D11Ertd759e

MMRRC Submission

043344-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5726 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

119283926-119378244 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119307284 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 648 (Y648C)

Ref Sequence

ENSEMBL: ENSMUSP00000115063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093902] [ENSMUST00000131035]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000093902
AA Change: Y648C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000091429
Gene: ENSMUSG00000070327
AA Change: Y648C

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1114	1128	N/A	INTRINSIC
low complexity region	1546	1558	N/A	INTRINSIC
AAA	2373	2515	2.82e-2	SMART
AAA	2722	2890	3.63e-1	SMART
low complexity region	3449	3459	N/A	INTRINSIC
RING	3947	3985	8.69e-5	SMART
Blast:PP2Ac	4544	4722	3e-66	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000131035
AA Change: Y648C

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000115063
Gene: ENSMUSG00000070327
AA Change: Y648C

Domain	Start	End	E-Value	Type
low complexity region	130	146	N/A	INTRINSIC
low complexity region	265	279	N/A	INTRINSIC
low complexity region	319	335	N/A	INTRINSIC
low complexity region	676	688	N/A	INTRINSIC
low complexity region	1113	1127	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
AAA	2372	2514	2.82e-2	SMART
AAA	2721	2889	3.63e-1	SMART
low complexity region	3448	3458	N/A	INTRINSIC
RING	3946	3984	8.69e-5	SMART
Blast:PP2Ac	4542	4720	3e-66	BLAST

Meta Mutation Damage Score

0.1420

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a C3HC4-type RING finger domain, which is a specialized type of Zn-finger that binds two atoms of zinc and is thought to be involved in mediating protein-protein interactions. The protein also contains an AAA domain, which is associated with ATPase activity. This gene is a susceptibility gene for Moyamoya disease, a vascular disorder of intracranial arteries. This gene is also a translocation partner in anaplastic large cell lymphoma and inflammatory myofibroblastic tumor cases, where a t(2;17)(p23;q25) translocation has been identified with the anaplastic lymphoma kinase (ALK) gene on chromosome 2, and a t(8;17)(q24;q25) translocation has been identified with the MYC gene on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and circulating glucose level but normal glucose tolerance, insulin sensitivity, insulin plasma levels and leptin plasma levels. [provided by MGI curators]

Allele List at MGI

All alleles(13) : Targeted, other(2) Gene trapped(11)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	T	C	7: 127,835,832 (GRCm39)	K254E	probably damaging	Het
Aak1	C	T	6: 86,902,106 (GRCm39)	Q92*	probably null	Het
Acss3	T	C	10: 106,959,183 (GRCm39)	T88A	possibly damaging	Het
Adcy4	A	T	14: 56,021,118 (GRCm39)	S6R	probably damaging	Het
Aldh1l2	T	C	10: 83,348,170 (GRCm39)	E311G	possibly damaging	Het
Arhgap25	C	T	6: 87,440,441 (GRCm39)	S402N	probably benign	Het
Btn1a1	T	A	13: 23,643,522 (GRCm39)	D309V	probably damaging	Het
Cdh23	C	T	10: 60,243,259 (GRCm39)	V1037M	probably damaging	Het
Clcn2	T	C	16: 20,529,285 (GRCm39)		probably benign	Het
Cln3	T	C	7: 126,174,673 (GRCm39)	T276A	probably null	Het
CN725425	A	G	15: 91,144,706 (GRCm39)	E523G	possibly damaging	Het
Crppa	T	C	12: 36,597,829 (GRCm39)	V320A	probably damaging	Het
Cspg4	A	T	9: 56,793,188 (GRCm39)	T308S	probably damaging	Het
Dgkh	G	T	14: 78,862,342 (GRCm39)	F208L	probably benign	Het
Eif2ak4	A	G	2: 118,273,613 (GRCm39)	D846G	probably damaging	Het
Fmo4	A	G	1: 162,635,828 (GRCm39)		probably null	Het
Foxp4	A	G	17: 48,180,033 (GRCm39)	Y623H	unknown	Het
Fxr2	T	C	11: 69,524,172 (GRCm39)	V10A	probably benign	Het
Gm10271	T	C	10: 116,792,792 (GRCm39)		probably null	Het
Gsk3b	T	C	16: 38,028,498 (GRCm39)		probably benign	Het
Ift43	T	A	12: 86,208,957 (GRCm39)	D169E	probably damaging	Het
Ift57	T	A	16: 49,519,861 (GRCm39)	L54H	probably damaging	Het
Ighv1-37	T	C	12: 114,860,294 (GRCm39)		probably benign	Het
Kl	A	G	5: 150,915,003 (GRCm39)	N910S	possibly damaging	Het
Lrp2	T	C	2: 69,339,491 (GRCm39)	D1140G	probably damaging	Het
Map1a	G	A	2: 121,135,546 (GRCm39)	A1883T	probably damaging	Het
Map4k2	G	T	19: 6,401,362 (GRCm39)	G611C	probably damaging	Het
Mical1	A	G	10: 41,359,692 (GRCm39)		probably benign	Het
Myh14	A	G	7: 44,292,886 (GRCm39)		probably null	Het
Myh8	T	A	11: 67,185,392 (GRCm39)	V881D	possibly damaging	Het
Myo1g	G	T	11: 6,459,420 (GRCm39)	Q817K	probably benign	Het
Nin	A	C	12: 70,124,953 (GRCm39)	V123G	probably damaging	Het
Nup160	A	G	2: 90,548,195 (GRCm39)	D976G	probably damaging	Het
Nup210l	A	T	3: 90,036,514 (GRCm39)		probably null	Het
Or5an1c	A	G	19: 12,218,644 (GRCm39)	I127T	probably damaging	Het
Phf14	T	C	6: 11,933,537 (GRCm39)		probably benign	Het
Podxl2	T	C	6: 88,825,721 (GRCm39)	D400G	probably damaging	Het
Pygl	C	T	12: 70,237,916 (GRCm39)	W707*	probably null	Het
Rnf19b	T	C	4: 128,965,685 (GRCm39)	V261A	possibly damaging	Het
Scn5a	C	T	9: 119,362,913 (GRCm39)	R569H	probably damaging	Het
Sdk2	A	G	11: 113,742,626 (GRCm39)	L761P	probably damaging	Het
Shroom3	C	T	5: 93,090,864 (GRCm39)	P1124S	probably benign	Het
Sirt4	A	G	5: 115,617,705 (GRCm39)	V317A	probably benign	Het
Skic3	T	C	13: 76,266,466 (GRCm39)	Y238H	probably damaging	Het
Slc12a2	G	T	18: 58,029,426 (GRCm39)	A271S	probably benign	Het
Slc6a9	A	G	4: 117,721,210 (GRCm39)	Y208C	probably damaging	Het
Snap23	T	A	2: 120,414,752 (GRCm39)		probably benign	Het
Sra1	C	T	18: 36,803,226 (GRCm39)		probably benign	Het
Srbd1	C	T	17: 86,428,157 (GRCm39)	D359N	possibly damaging	Het
Srp19	A	G	18: 34,464,826 (GRCm39)	Y22C	probably damaging	Het
Sstr4	T	C	2: 148,238,003 (GRCm39)	S205P	probably damaging	Het
Sv2b	T	C	7: 74,773,962 (GRCm39)	D503G	possibly damaging	Het
Tbc1d30	C	T	10: 121,103,479 (GRCm39)	V518M	probably damaging	Het
Tlr4	A	G	4: 66,758,652 (GRCm39)	K482E	probably benign	Het
Tpm1	G	A	9: 66,930,694 (GRCm39)	L310F	probably damaging	Het
Trpm6	A	G	19: 18,830,981 (GRCm39)	Y1282C	probably damaging	Het
Tsc22d1	T	A	14: 76,742,757 (GRCm39)	L65*	probably null	Het
Ttc39c	C	A	18: 12,830,992 (GRCm39)	A284D	probably damaging	Het
Txndc16	G	A	14: 45,403,221 (GRCm39)	H297Y	probably benign	Het
Utrn	A	T	10: 12,545,550 (GRCm39)	D1698E	probably benign	Het
Vmn1r232	C	T	17: 21,133,601 (GRCm39)	R333H	probably benign	Het
Vmn2r14	A	T	5: 109,365,486 (GRCm39)	D529E	possibly damaging	Het
Vmn2r70	C	T	7: 85,208,315 (GRCm39)	V721I	probably damaging	Het
Zbtb18	A	G	1: 177,276,119 (GRCm39)	H484R	probably damaging	Het
Zc3h13	T	A	14: 75,568,269 (GRCm39)	S1187R	possibly damaging	Het
Zfhx4	T	A	3: 5,468,381 (GRCm39)	D2846E	probably benign	Het

Other mutations in Rnf213

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Rnf213	APN	11	119,340,169 (GRCm39)	missense	probably benign	0.00
IGL00961:Rnf213	APN	11	119,331,669 (GRCm39)	missense	possibly damaging	0.55
IGL01324:Rnf213	APN	11	119,338,063 (GRCm39)	missense	probably damaging	1.00
IGL01351:Rnf213	APN	11	119,373,944 (GRCm39)	missense	probably benign	0.25
IGL01403:Rnf213	APN	11	119,334,126 (GRCm39)	missense	probably damaging	1.00
IGL01704:Rnf213	APN	11	119,340,702 (GRCm39)	critical splice donor site	probably null
IGL01765:Rnf213	APN	11	119,327,178 (GRCm39)	missense	probably benign	0.00
IGL01803:Rnf213	APN	11	119,332,133 (GRCm39)	missense	probably damaging	1.00
IGL01804:Rnf213	APN	11	119,333,092 (GRCm39)	missense	probably damaging	1.00
IGL01900:Rnf213	APN	11	119,333,841 (GRCm39)	missense	probably benign	0.05
IGL01944:Rnf213	APN	11	119,307,283 (GRCm39)	missense	probably benign	0.01
IGL01982:Rnf213	APN	11	119,334,094 (GRCm39)	missense	probably damaging	1.00
IGL02008:Rnf213	APN	11	119,309,135 (GRCm39)	splice site	probably benign
IGL02084:Rnf213	APN	11	119,336,499 (GRCm39)	missense	probably benign	0.04
IGL02253:Rnf213	APN	11	119,331,476 (GRCm39)	missense	probably benign	0.03
IGL02254:Rnf213	APN	11	119,371,733 (GRCm39)	missense	possibly damaging	0.89
IGL02296:Rnf213	APN	11	119,354,162 (GRCm39)	missense	probably benign	0.01
IGL02531:Rnf213	APN	11	119,327,628 (GRCm39)	missense	probably benign
IGL02588:Rnf213	APN	11	119,307,362 (GRCm39)	missense	probably benign	0.30
IGL02615:Rnf213	APN	11	119,331,615 (GRCm39)	missense	probably damaging	0.96
IGL02805:Rnf213	APN	11	119,325,892 (GRCm39)	missense	probably damaging	0.99
IGL02887:Rnf213	APN	11	119,318,336 (GRCm39)	missense	probably damaging	1.00
IGL03001:Rnf213	APN	11	119,370,767 (GRCm39)	missense	probably damaging	1.00
IGL03035:Rnf213	APN	11	119,336,452 (GRCm39)	splice site	probably benign
IGL03057:Rnf213	APN	11	119,331,913 (GRCm39)	missense	probably damaging	1.00
IGL03148:Rnf213	APN	11	119,355,833 (GRCm39)	missense	probably damaging	1.00
IGL03308:Rnf213	APN	11	119,364,998 (GRCm39)	missense	probably benign	0.03
IGL03339:Rnf213	APN	11	119,333,830 (GRCm39)	missense	probably damaging	1.00
IGL03369:Rnf213	APN	11	119,312,294 (GRCm39)	missense	probably benign	0.34
attrition	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
defame	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
Derogate	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
dinky	UTSW	11	119,307,284 (GRCm39)	missense	probably damaging	0.99
G1funyon_rnf213_024	UTSW	11	119,325,568 (GRCm39)	missense
Impugn	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332_Rnf213_642	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
B6584:Rnf213	UTSW	11	119,316,895 (GRCm39)	missense	probably damaging	0.97
G1Funyon:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
PIT4585001:Rnf213	UTSW	11	119,349,218 (GRCm39)	missense
R0008:Rnf213	UTSW	11	119,355,878 (GRCm39)	missense	possibly damaging	0.82
R0015:Rnf213	UTSW	11	119,332,432 (GRCm39)	missense	possibly damaging	0.95
R0041:Rnf213	UTSW	11	119,293,401 (GRCm39)	missense	probably benign	0.41
R0114:Rnf213	UTSW	11	119,305,413 (GRCm39)	missense	probably damaging	1.00
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0131:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0132:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R0138:Rnf213	UTSW	11	119,307,322 (GRCm39)	missense	probably benign	0.05
R0144:Rnf213	UTSW	11	119,370,426 (GRCm39)	nonsense	probably null
R0184:Rnf213	UTSW	11	119,305,347 (GRCm39)	missense	probably damaging	0.99
R0321:Rnf213	UTSW	11	119,328,931 (GRCm39)	nonsense	probably null
R0365:Rnf213	UTSW	11	119,316,937 (GRCm39)	missense	possibly damaging	0.74
R0415:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
R0421:Rnf213	UTSW	11	119,338,083 (GRCm39)	missense	probably damaging	1.00
R0494:Rnf213	UTSW	11	119,316,838 (GRCm39)	missense	possibly damaging	0.65
R0494:Rnf213	UTSW	11	119,333,946 (GRCm39)	missense	probably damaging	1.00
R0549:Rnf213	UTSW	11	119,355,908 (GRCm39)	missense	probably damaging	1.00
R0577:Rnf213	UTSW	11	119,334,106 (GRCm39)	missense	probably damaging	1.00
R0605:Rnf213	UTSW	11	119,322,543 (GRCm39)	missense	probably benign	0.03
R0638:Rnf213	UTSW	11	119,361,036 (GRCm39)	missense	probably damaging	1.00
R0675:Rnf213	UTSW	11	119,332,660 (GRCm39)	missense	probably benign	0.28
R0715:Rnf213	UTSW	11	119,331,976 (GRCm39)	missense	probably damaging	0.97
R0732:Rnf213	UTSW	11	119,331,894 (GRCm39)	missense	probably damaging	0.99
R0748:Rnf213	UTSW	11	119,364,306 (GRCm39)	missense	probably damaging	1.00
R0765:Rnf213	UTSW	11	119,313,921 (GRCm39)	critical splice donor site	probably null
R0890:Rnf213	UTSW	11	119,321,312 (GRCm39)	missense	possibly damaging	0.94
R0927:Rnf213	UTSW	11	119,305,396 (GRCm39)	missense	probably benign	0.00
R0940:Rnf213	UTSW	11	119,307,389 (GRCm39)	missense	probably benign	0.10
R0959:Rnf213	UTSW	11	119,343,407 (GRCm39)	missense	probably damaging	0.99
R1077:Rnf213	UTSW	11	119,376,824 (GRCm39)	splice site	probably benign
R1104:Rnf213	UTSW	11	119,368,055 (GRCm39)	missense	probably benign	0.29
R1141:Rnf213	UTSW	11	119,326,809 (GRCm39)	missense	probably benign	0.02
R1219:Rnf213	UTSW	11	119,327,003 (GRCm39)	missense	probably damaging	1.00
R1435:Rnf213	UTSW	11	119,326,831 (GRCm39)	missense	probably damaging	1.00
R1444:Rnf213	UTSW	11	119,333,226 (GRCm39)	missense	probably damaging	1.00
R1474:Rnf213	UTSW	11	119,328,576 (GRCm39)	missense	probably damaging	1.00
R1488:Rnf213	UTSW	11	119,371,715 (GRCm39)	missense	probably benign	0.05
R1523:Rnf213	UTSW	11	119,332,714 (GRCm39)	missense	probably damaging	1.00
R1548:Rnf213	UTSW	11	119,333,533 (GRCm39)	missense	probably damaging	1.00
R1554:Rnf213	UTSW	11	119,332,665 (GRCm39)	missense	probably benign	0.06
R1563:Rnf213	UTSW	11	119,305,352 (GRCm39)	missense	probably benign	0.13
R1572:Rnf213	UTSW	11	119,327,437 (GRCm39)	missense	probably damaging	1.00
R1585:Rnf213	UTSW	11	119,354,171 (GRCm39)	missense	probably damaging	1.00
R1635:Rnf213	UTSW	11	119,333,405 (GRCm39)	missense	probably damaging	0.97
R1663:Rnf213	UTSW	11	119,328,498 (GRCm39)	missense	probably benign	0.01
R1789:Rnf213	UTSW	11	119,331,047 (GRCm39)	missense	probably damaging	0.97
R1844:Rnf213	UTSW	11	119,332,009 (GRCm39)	missense	probably damaging	1.00
R1871:Rnf213	UTSW	11	119,340,955 (GRCm39)	missense	probably benign	0.08
R1893:Rnf213	UTSW	11	119,307,274 (GRCm39)	missense	probably damaging	1.00
R1937:Rnf213	UTSW	11	119,322,511 (GRCm39)	missense	probably damaging	1.00
R1967:Rnf213	UTSW	11	119,371,721 (GRCm39)	missense	probably damaging	1.00
R1987:Rnf213	UTSW	11	119,331,933 (GRCm39)	missense	probably damaging	1.00
R2000:Rnf213	UTSW	11	119,326,848 (GRCm39)	missense	probably damaging	1.00
R2020:Rnf213	UTSW	11	119,352,744 (GRCm39)	missense	probably damaging	0.99
R2100:Rnf213	UTSW	11	119,358,128 (GRCm39)	nonsense	probably null
R2109:Rnf213	UTSW	11	119,333,489 (GRCm39)	nonsense	probably null
R2115:Rnf213	UTSW	11	119,318,839 (GRCm39)	missense	probably benign	0.00
R2126:Rnf213	UTSW	11	119,341,027 (GRCm39)	missense	probably damaging	0.99
R2144:Rnf213	UTSW	11	119,334,516 (GRCm39)	missense	probably damaging	0.99
R2145:Rnf213	UTSW	11	119,306,019 (GRCm39)	missense	probably benign	0.03
R2168:Rnf213	UTSW	11	119,305,896 (GRCm39)	missense	probably damaging	0.97
R2189:Rnf213	UTSW	11	119,321,187 (GRCm39)	missense	probably benign	0.10
R2199:Rnf213	UTSW	11	119,350,835 (GRCm39)	missense	probably benign	0.01
R2220:Rnf213	UTSW	11	119,327,254 (GRCm39)	missense	possibly damaging	0.94
R2336:Rnf213	UTSW	11	119,305,430 (GRCm39)	missense	probably benign	0.02
R2400:Rnf213	UTSW	11	119,334,021 (GRCm39)	missense	probably damaging	1.00
R2679:Rnf213	UTSW	11	119,350,764 (GRCm39)	splice site	probably null
R2698:Rnf213	UTSW	11	119,300,970 (GRCm39)	missense	probably benign	0.26
R3151:Rnf213	UTSW	11	119,359,718 (GRCm39)	missense	probably benign	0.03
R3607:Rnf213	UTSW	11	119,332,802 (GRCm39)	nonsense	probably null
R3808:Rnf213	UTSW	11	119,370,384 (GRCm39)	missense	probably damaging	1.00
R3854:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3856:Rnf213	UTSW	11	119,371,765 (GRCm39)	splice site	probably benign
R3973:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R4014:Rnf213	UTSW	11	119,336,555 (GRCm39)	nonsense	probably null
R4049:Rnf213	UTSW	11	119,373,274 (GRCm39)	missense	possibly damaging	0.67
R4130:Rnf213	UTSW	11	119,373,832 (GRCm39)	missense	probably damaging	1.00
R4153:Rnf213	UTSW	11	119,300,308 (GRCm39)	missense	probably benign	0.27
R4167:Rnf213	UTSW	11	119,332,069 (GRCm39)	missense	probably damaging	0.99
R4224:Rnf213	UTSW	11	119,327,649 (GRCm39)	nonsense	probably null
R4332:Rnf213	UTSW	11	119,327,502 (GRCm39)	missense	probably damaging	1.00
R4415:Rnf213	UTSW	11	119,374,790 (GRCm39)	missense	probably damaging	0.99
R4547:Rnf213	UTSW	11	119,370,496 (GRCm39)	critical splice donor site	probably null
R4609:Rnf213	UTSW	11	119,328,521 (GRCm39)	missense	possibly damaging	0.86
R4684:Rnf213	UTSW	11	119,331,951 (GRCm39)	missense	probably damaging	1.00
R4704:Rnf213	UTSW	11	119,331,175 (GRCm39)	missense	probably damaging	1.00
R4719:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R4751:Rnf213	UTSW	11	119,336,571 (GRCm39)	missense	probably benign	0.12
R4828:Rnf213	UTSW	11	119,307,455 (GRCm39)	missense	possibly damaging	0.61
R4837:Rnf213	UTSW	11	119,333,589 (GRCm39)	missense	probably benign	0.00
R4894:Rnf213	UTSW	11	119,372,066 (GRCm39)	missense	probably damaging	1.00
R4973:Rnf213	UTSW	11	119,318,983 (GRCm39)	missense	possibly damaging	0.84
R5026:Rnf213	UTSW	11	119,327,590 (GRCm39)	missense	probably damaging	1.00
R5034:Rnf213	UTSW	11	119,301,633 (GRCm39)	missense	probably damaging	0.99
R5284:Rnf213	UTSW	11	119,349,692 (GRCm39)	missense	possibly damaging	0.89
R5295:Rnf213	UTSW	11	119,331,642 (GRCm39)	missense	probably benign	0.00
R5406:Rnf213	UTSW	11	119,331,634 (GRCm39)	missense	probably damaging	1.00
R5441:Rnf213	UTSW	11	119,299,846 (GRCm39)	missense	probably damaging	0.99
R5449:Rnf213	UTSW	11	119,305,902 (GRCm39)	missense	probably benign	0.44
R5520:Rnf213	UTSW	11	119,324,325 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,731 (GRCm39)	missense	probably damaging	1.00
R5636:Rnf213	UTSW	11	119,327,455 (GRCm39)	missense	probably benign	0.04
R5669:Rnf213	UTSW	11	119,349,611 (GRCm39)	missense	possibly damaging	0.92
R5670:Rnf213	UTSW	11	119,325,512 (GRCm39)	critical splice acceptor site	probably null
R5697:Rnf213	UTSW	11	119,374,720 (GRCm39)	missense	possibly damaging	0.54
R5808:Rnf213	UTSW	11	119,327,121 (GRCm39)	missense	probably benign
R5861:Rnf213	UTSW	11	119,364,203 (GRCm39)	missense	probably damaging	1.00
R5903:Rnf213	UTSW	11	119,312,195 (GRCm39)	missense	probably damaging	0.98
R5949:Rnf213	UTSW	11	119,333,905 (GRCm39)	missense	probably damaging	1.00
R6022:Rnf213	UTSW	11	119,376,836 (GRCm39)	missense	probably benign	0.00
R6043:Rnf213	UTSW	11	119,332,927 (GRCm39)	missense	probably damaging	0.97
R6089:Rnf213	UTSW	11	119,307,385 (GRCm39)	missense	probably benign	0.14
R6123:Rnf213	UTSW	11	119,302,339 (GRCm39)	missense	probably damaging	0.96
R6134:Rnf213	UTSW	11	119,302,296 (GRCm39)	missense	probably damaging	0.99
R6135:Rnf213	UTSW	11	119,332,854 (GRCm39)	missense	probably benign	0.02
R6146:Rnf213	UTSW	11	119,326,825 (GRCm39)	missense	probably benign	0.41
R6163:Rnf213	UTSW	11	119,349,254 (GRCm39)	missense	possibly damaging	0.86
R6272:Rnf213	UTSW	11	119,305,374 (GRCm39)	missense	probably damaging	1.00
R6333:Rnf213	UTSW	11	119,354,192 (GRCm39)	missense	probably damaging	1.00
R6370:Rnf213	UTSW	11	119,367,904 (GRCm39)	missense	probably damaging	0.99
R6456:Rnf213	UTSW	11	119,350,792 (GRCm39)	missense	probably benign	0.03
R6468:Rnf213	UTSW	11	119,343,513 (GRCm39)	missense	possibly damaging	0.94
R6579:Rnf213	UTSW	11	119,327,106 (GRCm39)	missense	probably damaging	0.96
R6648:Rnf213	UTSW	11	119,370,746 (GRCm39)	missense	possibly damaging	0.81
R6727:Rnf213	UTSW	11	119,321,147 (GRCm39)	missense	possibly damaging	0.77
R6739:Rnf213	UTSW	11	119,333,097 (GRCm39)	missense	probably damaging	1.00
R6768:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense	probably damaging	0.99
R6817:Rnf213	UTSW	11	119,353,111 (GRCm39)	critical splice donor site	probably null
R6820:Rnf213	UTSW	11	119,339,664 (GRCm39)	missense	probably damaging	1.00
R6841:Rnf213	UTSW	11	119,340,692 (GRCm39)	missense	probably benign	0.26
R6934:Rnf213	UTSW	11	119,310,893 (GRCm39)	missense	probably benign	0.38
R7026:Rnf213	UTSW	11	119,370,481 (GRCm39)	missense	possibly damaging	0.58
R7094:Rnf213	UTSW	11	119,328,430 (GRCm39)	splice site	probably null
R7170:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7185:Rnf213	UTSW	11	119,315,024 (GRCm39)	missense
R7239:Rnf213	UTSW	11	119,349,614 (GRCm39)	missense
R7258:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7259:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7260:Rnf213	UTSW	11	119,343,401 (GRCm39)	missense
R7273:Rnf213	UTSW	11	119,322,582 (GRCm39)	splice site	probably null
R7282:Rnf213	UTSW	11	119,328,818 (GRCm39)	missense
R7311:Rnf213	UTSW	11	119,307,373 (GRCm39)	missense
R7352:Rnf213	UTSW	11	119,334,405 (GRCm39)	missense
R7369:Rnf213	UTSW	11	119,321,294 (GRCm39)	missense
R7410:Rnf213	UTSW	11	119,325,877 (GRCm39)	missense
R7448:Rnf213	UTSW	11	119,372,117 (GRCm39)	missense
R7561:Rnf213	UTSW	11	119,332,545 (GRCm39)	missense
R7573:Rnf213	UTSW	11	119,349,310 (GRCm39)	missense
R7615:Rnf213	UTSW	11	119,358,123 (GRCm39)	missense
R7680:Rnf213	UTSW	11	119,370,382 (GRCm39)	missense
R7739:Rnf213	UTSW	11	119,301,687 (GRCm39)	missense
R7789:Rnf213	UTSW	11	119,361,045 (GRCm39)	splice site	probably null
R7806:Rnf213	UTSW	11	119,302,371 (GRCm39)	missense
R8031:Rnf213	UTSW	11	119,321,107 (GRCm39)	nonsense	probably null
R8042:Rnf213	UTSW	11	119,332,480 (GRCm39)	missense
R8053:Rnf213	UTSW	11	119,293,473 (GRCm39)	missense
R8284:Rnf213	UTSW	11	119,318,909 (GRCm39)	missense
R8301:Rnf213	UTSW	11	119,325,568 (GRCm39)	missense
R8325:Rnf213	UTSW	11	119,321,271 (GRCm39)	missense
R8332:Rnf213	UTSW	11	119,374,524 (GRCm39)	missense
R8443:Rnf213	UTSW	11	119,340,149 (GRCm39)	missense
R8518:Rnf213	UTSW	11	119,353,043 (GRCm39)	missense
R8531:Rnf213	UTSW	11	119,365,031 (GRCm39)	missense	probably benign	0.02
R8670:Rnf213	UTSW	11	119,349,563 (GRCm39)	missense
R8675:Rnf213	UTSW	11	119,346,984 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,332,038 (GRCm39)	missense
R8690:Rnf213	UTSW	11	119,308,955 (GRCm39)	missense
R8714:Rnf213	UTSW	11	119,359,720 (GRCm39)	missense
R8802:Rnf213	UTSW	11	119,352,928 (GRCm39)	missense
R8861:Rnf213	UTSW	11	119,333,062 (GRCm39)	missense
R8886:Rnf213	UTSW	11	119,364,264 (GRCm39)	missense
R8893:Rnf213	UTSW	11	119,333,868 (GRCm39)	missense
R8937:Rnf213	UTSW	11	119,321,100 (GRCm39)	missense	possibly damaging	0.94
R8941:Rnf213	UTSW	11	119,305,250 (GRCm39)	missense	probably damaging	1.00
R8973:Rnf213	UTSW	11	119,352,756 (GRCm39)	missense
R8983:Rnf213	UTSW	11	119,321,175 (GRCm39)	missense
R9043:Rnf213	UTSW	11	119,349,739 (GRCm39)	missense
R9081:Rnf213	UTSW	11	119,357,062 (GRCm39)	missense
R9132:Rnf213	UTSW	11	119,374,742 (GRCm39)	missense
R9135:Rnf213	UTSW	11	119,299,573 (GRCm39)	missense
R9146:Rnf213	UTSW	11	119,334,499 (GRCm39)	missense
R9156:Rnf213	UTSW	11	119,331,574 (GRCm39)	missense
R9183:Rnf213	UTSW	11	119,318,448 (GRCm39)	missense
R9234:Rnf213	UTSW	11	119,340,943 (GRCm39)	missense
R9275:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9278:Rnf213	UTSW	11	119,326,768 (GRCm39)	missense
R9296:Rnf213	UTSW	11	119,334,621 (GRCm39)	splice site	probably benign
R9350:Rnf213	UTSW	11	119,332,975 (GRCm39)	missense
R9366:Rnf213	UTSW	11	119,327,057 (GRCm39)	missense
R9413:Rnf213	UTSW	11	119,357,059 (GRCm39)	missense
R9444:Rnf213	UTSW	11	119,325,623 (GRCm39)	missense
R9464:Rnf213	UTSW	11	119,354,406 (GRCm39)	missense
R9605:Rnf213	UTSW	11	119,359,879 (GRCm39)	missense
R9649:Rnf213	UTSW	11	119,370,457 (GRCm39)	missense
R9651:Rnf213	UTSW	11	119,331,238 (GRCm39)	missense
R9664:Rnf213	UTSW	11	119,332,794 (GRCm39)	missense
R9696:Rnf213	UTSW	11	119,359,806 (GRCm39)	missense
R9710:Rnf213	UTSW	11	119,331,831 (GRCm39)	missense
R9797:Rnf213	UTSW	11	119,333,365 (GRCm39)	missense
S24628:Rnf213	UTSW	11	119,305,295 (GRCm39)	missense	probably damaging	1.00
X0021:Rnf213	UTSW	11	119,332,650 (GRCm39)	missense	probably benign	0.14
X0062:Rnf213	UTSW	11	119,364,339 (GRCm39)	missense	probably benign	0.05
X0064:Rnf213	UTSW	11	119,331,289 (GRCm39)	missense	probably damaging	1.00
Z1088:Rnf213	UTSW	11	119,368,080 (GRCm39)	missense	possibly damaging	0.69
Z1176:Rnf213	UTSW	11	119,373,824 (GRCm39)	missense
Z1176:Rnf213	UTSW	11	119,332,236 (GRCm39)	missense

Predicted Primers

PCR Primer
(F):5'- GGAATCTGCTCTGGGGATTC -3'
(R):5'- GCTCTTCAGCTTACCTAGTGG -3'

Sequencing Primer
(F):5'- AATCTGCTCTGGGGATTCCTTGAG -3'
(R):5'- GGGTGCTTTGTCCCGAAACTC -3'

Posted On

2017-01-03