Incidental Mutation 'R5726:Ttc37'
ID452515
Institutional Source Beutler Lab
Gene Symbol Ttc37
Ensembl Gene ENSMUSG00000033991
Gene Nametetratricopeptide repeat domain 37
Synonyms
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location76098734-76190316 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76118347 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 238 (Y238H)
Ref Sequence ENSEMBL: ENSMUSP00000153521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091466] [ENSMUST00000224386]
Predicted Effect probably damaging
Transcript: ENSMUST00000091466
AA Change: Y238H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000089045
Gene: ENSMUSG00000033991
AA Change: Y238H

DomainStartEndE-ValueType
TPR 6 39 2.92e1 SMART
TPR 40 73 1.1e-1 SMART
TPR 272 305 9.45e0 SMART
TPR 306 339 8.9e-2 SMART
SEL1 420 451 1.45e2 SMART
TPR 420 453 2.55e-2 SMART
SEL1 454 490 1.15e1 SMART
TPR 454 492 2.84e1 SMART
TPR 493 527 1.92e1 SMART
TPR 564 597 7.34e-3 SMART
TPR 598 631 1.81e-2 SMART
TPR 632 665 2.43e1 SMART
low complexity region 728 739 N/A INTRINSIC
SEL1 861 892 3.58e1 SMART
TPR 861 894 2.14e-4 SMART
TPR 980 1013 1.56e1 SMART
Blast:TPR 1051 1084 7e-11 BLAST
Blast:TPR 1088 1121 7e-10 BLAST
TPR 1399 1432 4.31e0 SMART
low complexity region 1438 1450 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000224386
AA Change: Y238H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect unknown
Transcript: ENSMUST00000224790
AA Change: Y104H
Meta Mutation Damage Score 0.3370 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with twenty tetratricopeptide (TPR) repeats. Tetratricopeptide repeat containing motifs are found in a variety of proteins and may mediate protein-protein interactions and chaperone activity. Mutations in this gene are associated with trichohepatoenteric syndrome. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Ttc37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Ttc37 APN 13 76143278 critical splice donor site probably null
IGL00650:Ttc37 APN 13 76127507 missense possibly damaging 0.89
IGL00838:Ttc37 APN 13 76134791 missense probably damaging 0.99
IGL00958:Ttc37 APN 13 76122745 missense probably damaging 0.98
IGL01011:Ttc37 APN 13 76122665 missense probably damaging 0.97
IGL01062:Ttc37 APN 13 76155462 nonsense probably null
IGL01319:Ttc37 APN 13 76129379 missense probably benign 0.29
IGL01697:Ttc37 APN 13 76128733 missense probably benign 0.01
IGL02061:Ttc37 APN 13 76129541 critical splice donor site probably null
IGL02184:Ttc37 APN 13 76111691 missense probably damaging 1.00
IGL02309:Ttc37 APN 13 76127047 missense possibly damaging 0.90
IGL03230:Ttc37 APN 13 76155647 splice site probably benign
IGL03354:Ttc37 APN 13 76182822 missense possibly damaging 0.71
caviar UTSW 13 76147767 missense possibly damaging 0.54
gourmet UTSW 13 76150519 missense probably damaging 1.00
tartare UTSW 13 76185179 missense probably damaging 0.96
R0501:Ttc37 UTSW 13 76147806 missense probably benign
R0628:Ttc37 UTSW 13 76150729 missense possibly damaging 0.89
R0711:Ttc37 UTSW 13 76182891 missense probably damaging 1.00
R0928:Ttc37 UTSW 13 76113592 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1402:Ttc37 UTSW 13 76131414 missense probably damaging 1.00
R1524:Ttc37 UTSW 13 76138372 missense probably benign 0.01
R1628:Ttc37 UTSW 13 76111791 missense possibly damaging 0.75
R1702:Ttc37 UTSW 13 76122743 missense possibly damaging 0.66
R1750:Ttc37 UTSW 13 76140601 missense possibly damaging 0.89
R1822:Ttc37 UTSW 13 76130288 missense probably benign 0.35
R1885:Ttc37 UTSW 13 76113047 missense probably benign 0.00
R1885:Ttc37 UTSW 13 76130235 missense probably benign 0.11
R1923:Ttc37 UTSW 13 76134770 missense probably damaging 1.00
R1978:Ttc37 UTSW 13 76134815 missense probably benign 0.00
R2040:Ttc37 UTSW 13 76180103 missense probably damaging 1.00
R2136:Ttc37 UTSW 13 76173354 missense possibly damaging 0.87
R2268:Ttc37 UTSW 13 76112274 unclassified probably benign
R2483:Ttc37 UTSW 13 76182867 missense probably damaging 1.00
R2988:Ttc37 UTSW 13 76155689 missense probably benign 0.11
R3701:Ttc37 UTSW 13 76113679 missense probably benign
R3951:Ttc37 UTSW 13 76130219 missense probably damaging 1.00
R4405:Ttc37 UTSW 13 76155665 missense probably damaging 0.97
R4411:Ttc37 UTSW 13 76127504 missense possibly damaging 0.89
R4957:Ttc37 UTSW 13 76185113 unclassified probably null
R4960:Ttc37 UTSW 13 76185156 missense possibly damaging 0.95
R4993:Ttc37 UTSW 13 76182936 missense probably damaging 0.96
R5206:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5208:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5302:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5305:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5306:Ttc37 UTSW 13 76147767 missense possibly damaging 0.54
R5579:Ttc37 UTSW 13 76185200 missense probably damaging 1.00
R5618:Ttc37 UTSW 13 76173426 missense probably benign
R5813:Ttc37 UTSW 13 76155733 missense probably benign 0.05
R5899:Ttc37 UTSW 13 76111819 splice site probably null
R6146:Ttc37 UTSW 13 76185240 missense probably damaging 1.00
R6224:Ttc37 UTSW 13 76118291 missense probably benign 0.02
R6286:Ttc37 UTSW 13 76143240 missense probably damaging 1.00
R6402:Ttc37 UTSW 13 76135270 missense probably benign 0.05
R6561:Ttc37 UTSW 13 76150519 missense probably damaging 1.00
R6808:Ttc37 UTSW 13 76185179 missense probably damaging 0.96
R7054:Ttc37 UTSW 13 76134960 missense probably damaging 1.00
R7261:Ttc37 UTSW 13 76113579 missense probably benign 0.30
R7267:Ttc37 UTSW 13 76180077 missense probably benign 0.15
R7348:Ttc37 UTSW 13 76182884 missense possibly damaging 0.82
R7384:Ttc37 UTSW 13 76150735 missense possibly damaging 0.53
R7404:Ttc37 UTSW 13 76148747 nonsense probably null
R7421:Ttc37 UTSW 13 76148825 missense probably benign 0.12
R7546:Ttc37 UTSW 13 76134835 missense probably damaging 1.00
R7771:Ttc37 UTSW 13 76135030 missense probably benign 0.21
R8125:Ttc37 UTSW 13 76130327 critical splice donor site probably null
R8136:Ttc37 UTSW 13 76113103 missense probably benign 0.00
X0067:Ttc37 UTSW 13 76132933 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGCAGATAACATTCCCAGTGAAG -3'
(R):5'- GCACTACCTGTCAGATCTCC -3'

Sequencing Primer
(F):5'- GTGAAGATCACCAAGTACTTTACAGG -3'
(R):5'- CAGATCTCCTCTATCTAATGTCAGAG -3'
Posted On2017-01-03