Incidental Mutation 'R5726:Adcy4'
ID452517
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Nameadenylate cyclase 4
Synonyms
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score140
Status Validated
Chromosome14
Chromosomal Location55769057-55784095 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55783661 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 6 (S6R)
Ref Sequence ENSEMBL: ENSMUSP00000130530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000022830] [ENSMUST00000168716] [ENSMUST00000170223] [ENSMUST00000178399] [ENSMUST00000227031] [ENSMUST00000228326] [ENSMUST00000228476]
Predicted Effect probably damaging
Transcript: ENSMUST00000002398
AA Change: S6R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: S6R

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022830
SMART Domains Protein: ENSMUSP00000022830
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 22 288 2.8e-38 PFAM
Pfam:Pkinase_Tyr 22 288 3e-34 PFAM
Pfam:RHIM 408 458 2.4e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168716
SMART Domains Protein: ENSMUSP00000126306
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170223
AA Change: S6R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: S6R

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000178399
SMART Domains Protein: ENSMUSP00000137278
Gene: ENSMUSG00000022221

DomainStartEndE-ValueType
Pfam:Pkinase 1 223 1.2e-30 PFAM
Pfam:Pkinase_Tyr 1 224 3.1e-27 PFAM
Pfam:RHIM 344 395 2.4e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226203
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226361
Predicted Effect unknown
Transcript: ENSMUST00000227031
AA Change: S6R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228077
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228175
Predicted Effect probably benign
Transcript: ENSMUST00000228326
Predicted Effect probably benign
Transcript: ENSMUST00000228476
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 55773663 splice site probably null
IGL02406:Adcy4 APN 14 55770047 missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 55771505 missense probably damaging 1.00
IGL02543:Adcy4 APN 14 55769170 missense probably benign
IGL02616:Adcy4 APN 14 55783514 unclassified probably null
IGL03002:Adcy4 APN 14 55773556 missense probably benign 0.31
IGL03026:Adcy4 APN 14 55778010 missense probably damaging 1.00
IGL03190:Adcy4 APN 14 55779053 missense probably damaging 1.00
IGL03247:Adcy4 APN 14 55770096 missense probably damaging 1.00
stressed UTSW 14 55779099 intron probably null
IGL03098:Adcy4 UTSW 14 55781581 missense probably null 0.82
R0098:Adcy4 UTSW 14 55769827 missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 55771533 missense probably benign 0.29
R0396:Adcy4 UTSW 14 55772288 missense probably benign 0.00
R0482:Adcy4 UTSW 14 55774572 critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 55781597 missense probably benign
R0691:Adcy4 UTSW 14 55772647 splice site probably benign
R0704:Adcy4 UTSW 14 55772756 missense probably benign
R0815:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R0863:Adcy4 UTSW 14 55783599 missense probably damaging 1.00
R1446:Adcy4 UTSW 14 55770023 critical splice donor site probably null
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 55778308 missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 55778939 missense probably damaging 1.00
R1624:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 55771472 missense probably benign 0.01
R1878:Adcy4 UTSW 14 55769905 missense probably damaging 0.96
R2007:Adcy4 UTSW 14 55778313 missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 55769170 missense probably benign 0.09
R2425:Adcy4 UTSW 14 55778017 missense probably damaging 0.99
R2517:Adcy4 UTSW 14 55781946 missense probably damaging 1.00
R3882:Adcy4 UTSW 14 55774546 missense probably benign 0.27
R4021:Adcy4 UTSW 14 55775178 intron probably null
R4022:Adcy4 UTSW 14 55775178 intron probably null
R4411:Adcy4 UTSW 14 55769443 missense probably damaging 1.00
R4530:Adcy4 UTSW 14 55779028 missense probably damaging 1.00
R4560:Adcy4 UTSW 14 55778950 unclassified probably null
R4704:Adcy4 UTSW 14 55775025 missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 55775036 missense probably benign 0.07
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 55781927 missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 55773722 missense probably benign
R4890:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4920:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4948:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4952:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4953:Adcy4 UTSW 14 55779029 missense probably damaging 1.00
R4987:Adcy4 UTSW 14 55773477 missense probably benign 0.01
R4991:Adcy4 UTSW 14 55773465 missense probably benign 0.03
R5080:Adcy4 UTSW 14 55772375 missense probably damaging 0.98
R5620:Adcy4 UTSW 14 55772367 nonsense probably null
R5652:Adcy4 UTSW 14 55773443 missense probably benign
R5910:Adcy4 UTSW 14 55779013 missense probably damaging 1.00
R5958:Adcy4 UTSW 14 55779099 intron probably null
R6280:Adcy4 UTSW 14 55779043 missense probably damaging 1.00
R6318:Adcy4 UTSW 14 55769224 missense probably damaging 1.00
R6598:Adcy4 UTSW 14 55770045 missense probably benign 0.03
R6947:Adcy4 UTSW 14 55778391 missense possibly damaging 0.92
R7012:Adcy4 UTSW 14 55779919 missense possibly damaging 0.95
R7147:Adcy4 UTSW 14 55779725 missense probably damaging 1.00
R7386:Adcy4 UTSW 14 55778327 missense probably damaging 1.00
R7414:Adcy4 UTSW 14 55781633 missense probably benign 0.15
R7431:Adcy4 UTSW 14 55772672 missense probably benign 0.01
R7490:Adcy4 UTSW 14 55770433 missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 55773465 missense probably benign 0.00
R7672:Adcy4 UTSW 14 55780905 missense probably benign 0.14
R8003:Adcy4 UTSW 14 55781635 missense probably benign 0.00
R8042:Adcy4 UTSW 14 55775239 missense probably benign 0.01
R8100:Adcy4 UTSW 14 55772265 nonsense probably null
X0025:Adcy4 UTSW 14 55770391 missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 55780956 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGAGCTCCCACATCTAGCC -3'
(R):5'- CAGGACACTAGCACGGTATG -3'

Sequencing Primer
(F):5'- ACATCTAGCCCATCTTACCCTG -3'
(R):5'- TAAAGAAGTCCTGTCACAGCTG -3'
Posted On2017-01-03