Incidental Mutation 'R5726:Dgkh'
ID452520
Institutional Source Beutler Lab
Gene Symbol Dgkh
Ensembl Gene ENSMUSG00000034731
Gene Namediacylglycerol kinase, eta
Synonyms5930402B05Rik
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location78558750-78732776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78624902 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 208 (F208L)
Ref Sequence ENSEMBL: ENSMUSP00000154036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074729] [ENSMUST00000226342] [ENSMUST00000227537] [ENSMUST00000227767] [ENSMUST00000228362]
Predicted Effect probably benign
Transcript: ENSMUST00000074729
AA Change: F208L

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000074290
Gene: ENSMUSG00000034731
AA Change: F208L

DomainStartEndE-ValueType
low complexity region 12 32 N/A INTRINSIC
PH 63 157 1.91e-19 SMART
C1 173 222 1.35e-16 SMART
C1 245 295 1.66e-7 SMART
DAGKc 329 454 3.11e-62 SMART
low complexity region 654 667 N/A INTRINSIC
low complexity region 715 730 N/A INTRINSIC
DAGKa 762 919 1.74e-92 SMART
low complexity region 1124 1134 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226342
AA Change: F208L

PolyPhen 2 Score 0.156 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000227537
AA Change: F93L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000227767
AA Change: F75L

PolyPhen 2 Score 0.062 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227820
Predicted Effect probably benign
Transcript: ENSMUST00000228362
AA Change: F75L

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0737 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family. Members of this family are involved in regulating intracellular concentrations of diacylglycerol and phosphatidic acid. Variation in this gene has been associated with bipolar disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Gsk3b T C 16: 38,208,136 probably benign Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Dgkh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dgkh APN 14 78609593 missense possibly damaging 0.92
IGL00767:Dgkh APN 14 78587261 splice site probably benign
IGL00787:Dgkh APN 14 78618514 splice site probably benign
IGL01503:Dgkh APN 14 78616270 missense possibly damaging 0.96
IGL02308:Dgkh APN 14 78587576 missense probably benign 0.01
IGL02707:Dgkh APN 14 78585651 missense possibly damaging 0.75
IGL02987:Dgkh APN 14 78589872 critical splice donor site probably null
IGL03058:Dgkh APN 14 78627797 missense probably benign 0.23
IGL03341:Dgkh APN 14 78595491 splice site probably benign
PIT1430001:Dgkh UTSW 14 78581513 missense probably damaging 1.00
PIT4445001:Dgkh UTSW 14 78575942 missense possibly damaging 0.91
R0153:Dgkh UTSW 14 78570129 nonsense probably null
R0730:Dgkh UTSW 14 78584479 missense probably damaging 0.99
R1136:Dgkh UTSW 14 78624889 missense probably damaging 1.00
R1162:Dgkh UTSW 14 78624451 missense probably damaging 1.00
R1689:Dgkh UTSW 14 78618544 missense possibly damaging 0.86
R1771:Dgkh UTSW 14 78609527 missense probably damaging 1.00
R1861:Dgkh UTSW 14 78578792 missense probably benign 0.04
R1916:Dgkh UTSW 14 78595223 missense probably damaging 0.97
R1930:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1931:Dgkh UTSW 14 78616505 missense probably damaging 1.00
R1956:Dgkh UTSW 14 78618541 missense probably damaging 1.00
R2007:Dgkh UTSW 14 78603049 missense probably benign 0.09
R3747:Dgkh UTSW 14 78584445 missense probably damaging 1.00
R4446:Dgkh UTSW 14 78628083 missense probably damaging 1.00
R4475:Dgkh UTSW 14 78589878 missense possibly damaging 0.80
R4965:Dgkh UTSW 14 78624421 missense probably damaging 1.00
R4970:Dgkh UTSW 14 78618637 missense probably damaging 1.00
R5071:Dgkh UTSW 14 78604532 missense probably damaging 1.00
R5652:Dgkh UTSW 14 78627761 missense probably damaging 1.00
R5773:Dgkh UTSW 14 78595455 missense probably damaging 1.00
R5855:Dgkh UTSW 14 78624504 critical splice acceptor site probably null
R6041:Dgkh UTSW 14 78587627 missense probably damaging 1.00
R6192:Dgkh UTSW 14 78628064 nonsense probably null
R6868:Dgkh UTSW 14 78624853 missense probably damaging 0.99
R6981:Dgkh UTSW 14 78627742 nonsense probably null
R7095:Dgkh UTSW 14 78627784 missense probably benign 0.07
R7473:Dgkh UTSW 14 78599043 missense probably benign 0.00
R7495:Dgkh UTSW 14 78578799 missense probably benign
R7711:Dgkh UTSW 14 78725019 missense probably benign
R7727:Dgkh UTSW 14 78595145 critical splice donor site probably null
R7823:Dgkh UTSW 14 78604481 missense probably benign
R7846:Dgkh UTSW 14 78618586 missense probably damaging 0.99
R7929:Dgkh UTSW 14 78618586 missense probably damaging 0.99
R8085:Dgkh UTSW 14 78587118 critical splice donor site probably null
R8285:Dgkh UTSW 14 78628126 missense probably benign 0.18
X0022:Dgkh UTSW 14 78595461 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTTCAGCAGAAATCTAGCTG -3'
(R):5'- TGACTGCTGGAGCTTAAACC -3'

Sequencing Primer
(F):5'- TCAGCAGAAATCTAGCTGAAGAG -3'
(R):5'- TTCGAGACAGGGTATGTAGCCC -3'
Posted On2017-01-03