Incidental Mutation 'R5726:Gsk3b'
ID452523
Institutional Source Beutler Lab
Gene Symbol Gsk3b
Ensembl Gene ENSMUSG00000022812
Gene Nameglycogen synthase kinase 3 beta
SynonymsGSK-3beta, 7330414F15Rik, GSK3, GSK-3, 8430431H08Rik
MMRRC Submission 043344-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R5726 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38089001-38246084 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 38208136 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000023507] [ENSMUST00000114750]
Predicted Effect probably benign
Transcript: ENSMUST00000023507
SMART Domains Protein: ENSMUSP00000023507
Gene: ENSMUSG00000022812

DomainStartEndE-ValueType
S_TKc 56 340 1.72e-86 SMART
low complexity region 386 402 N/A INTRINSIC
low complexity region 409 419 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114750
SMART Domains Protein: ENSMUSP00000110398
Gene: ENSMUSG00000022812

DomainStartEndE-ValueType
S_TKc 56 353 1.13e-86 SMART
low complexity region 399 415 N/A INTRINSIC
low complexity region 422 432 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184976
Predicted Effect probably benign
Transcript: ENSMUST00000231437
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in this gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene may die embryonically around mid-gestation or neonatally. When mice die neonatally, cleft palate and sternum are present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 K254E probably damaging Het
Aak1 C T 6: 86,925,124 Q92* probably null Het
Acss3 T C 10: 107,123,322 T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 S402N probably benign Het
Btn1a1 T A 13: 23,459,352 D309V probably damaging Het
Cdh23 C T 10: 60,407,480 V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 probably benign Het
Cln3 T C 7: 126,575,501 T276A probably null Het
CN725425 A G 15: 91,260,503 E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 T308S probably damaging Het
Dgkh G T 14: 78,624,902 F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 D846G probably damaging Het
Fmo4 A G 1: 162,808,259 probably null Het
Foxp4 A G 17: 47,869,108 Y623H unknown Het
Fxr2 T C 11: 69,633,346 V10A probably benign Het
Gm10271 T C 10: 116,956,887 probably null Het
Ift43 T A 12: 86,162,183 D169E probably damaging Het
Ift57 T A 16: 49,699,498 L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 probably benign Het
Ispd T C 12: 36,547,830 V320A probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 D1140G probably damaging Het
Map1a G A 2: 121,305,065 A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 G611C probably damaging Het
Mical1 A G 10: 41,483,696 probably benign Het
Myh14 A G 7: 44,643,462 probably null Het
Myh8 T A 11: 67,294,566 V881D possibly damaging Het
Myo1g G T 11: 6,509,420 Q817K probably benign Het
Nin A C 12: 70,078,179 V123G probably damaging Het
Nup160 A G 2: 90,717,851 D976G probably damaging Het
Nup210l A T 3: 90,129,207 probably null Het
Olfr262 A G 19: 12,241,280 I127T probably damaging Het
Phf14 T C 6: 11,933,538 probably benign Het
Podxl2 T C 6: 88,848,739 D400G probably damaging Het
Pygl C T 12: 70,191,142 W707* probably null Het
Rnf19b T C 4: 129,071,892 V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 Y648C probably damaging Het
Scn5a C T 9: 119,533,847 R569H probably damaging Het
Sdk2 A G 11: 113,851,800 L761P probably damaging Het
Shroom3 C T 5: 92,943,005 P1124S probably benign Het
Sirt4 A G 5: 115,479,646 V317A probably benign Het
Slc12a2 G T 18: 57,896,354 A271S probably benign Het
Slc6a9 A G 4: 117,864,013 Y208C probably damaging Het
Snap23 T A 2: 120,584,271 probably benign Het
Sra1 C T 18: 36,670,173 probably benign Het
Srbd1 C T 17: 86,120,729 D359N possibly damaging Het
Srp19 A G 18: 34,331,773 Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 S205P probably damaging Het
Sv2b T C 7: 75,124,214 D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 V518M probably damaging Het
Tlr4 A G 4: 66,840,415 K482E probably benign Het
Tpm1 G A 9: 67,023,412 L310F probably damaging Het
Trpm6 A G 19: 18,853,617 Y1282C probably damaging Het
Tsc22d1 T A 14: 76,505,317 L65* probably null Het
Ttc37 T C 13: 76,118,347 Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 A284D probably damaging Het
Txndc16 G A 14: 45,165,764 H297Y probably benign Het
Utrn A T 10: 12,669,806 D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 D2846E probably benign Het
Other mutations in Gsk3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Gsk3b APN 16 38228707 missense probably benign
IGL01302:Gsk3b APN 16 38220018 missense probably benign 0.01
blue_bunny UTSW 16 38208136 intron probably benign
PIT4402001:Gsk3b UTSW 16 38089401 unclassified probably benign
PIT4585001:Gsk3b UTSW 16 38184454 missense probably damaging 1.00
R0670:Gsk3b UTSW 16 38144316 missense probably damaging 1.00
R1118:Gsk3b UTSW 16 38207984 unclassified probably benign
R1119:Gsk3b UTSW 16 38207984 unclassified probably benign
R1428:Gsk3b UTSW 16 38090575 missense probably benign 0.01
R1897:Gsk3b UTSW 16 38217084 intron probably null
R2056:Gsk3b UTSW 16 38187909 missense probably benign
R2058:Gsk3b UTSW 16 38187909 missense probably benign
R2059:Gsk3b UTSW 16 38187909 missense probably benign
R4428:Gsk3b UTSW 16 38193936 missense probably damaging 1.00
R4594:Gsk3b UTSW 16 38170701 missense possibly damaging 0.92
R5133:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5134:Gsk3b UTSW 16 38240520 missense probably damaging 0.99
R5957:Gsk3b UTSW 16 38193953 missense probably damaging 1.00
R6273:Gsk3b UTSW 16 38208046 missense probably benign 0.00
R6431:Gsk3b UTSW 16 38193949 missense probably damaging 0.99
Z1176:Gsk3b UTSW 16 38208070 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTAGTCTGTGATGGTATAGCATG -3'
(R):5'- TACTTGCAAATGAAAGCCCAGG -3'

Sequencing Primer
(F):5'- GCAAAACCAATGCATCAATATATGGG -3'
(R):5'- GGCTGGCAAGTATCTACAAGTCATC -3'
Posted On2017-01-03