Incidental Mutation 'R0552:C9'
ID 45253
Institutional Source Beutler Lab
Gene Symbol C9
Ensembl Gene ENSMUSG00000022149
Gene Name complement component 9
Synonyms
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0552 (G1)
Quality Score 202
Status Not validated
Chromosome 15
Chromosomal Location 6445327-6498751 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 6445437 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 26 (I26F)
Ref Sequence ENSEMBL: ENSMUSP00000022749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022749] [ENSMUST00000078019] [ENSMUST00000080880] [ENSMUST00000110664]
AlphaFold P06683
Predicted Effect probably damaging
Transcript: ENSMUST00000022749
AA Change: I26F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022749
Gene: ENSMUSG00000022149
AA Change: I26F

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
TSP1 56 106 1.8e-6 SMART
LDLa 111 147 2.7e-12 SMART
MACPF 304 519 2.9e-52 SMART
Blast:EGF 525 556 4e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000078019
SMART Domains Protein: ENSMUSP00000077166
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 270 288 N/A INTRINSIC
low complexity region 292 306 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
PDB:3H8D|H 465 493 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000080880
SMART Domains Protein: ENSMUSP00000079689
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 488 506 N/A INTRINSIC
low complexity region 510 524 N/A INTRINSIC
low complexity region 553 573 N/A INTRINSIC
low complexity region 596 612 N/A INTRINSIC
PDB:3H8D|H 683 711 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110664
SMART Domains Protein: ENSMUSP00000106292
Gene: ENSMUSG00000022150

DomainStartEndE-ValueType
low complexity region 19 34 N/A INTRINSIC
PTB 45 179 1.16e-27 SMART
low complexity region 467 485 N/A INTRINSIC
low complexity region 489 503 N/A INTRINSIC
low complexity region 532 552 N/A INTRINSIC
low complexity region 575 591 N/A INTRINSIC
PDB:3H8D|H 662 690 3e-12 PDB
Predicted Effect unknown
Transcript: ENSMUST00000128097
AA Change: I22F
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in C9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:C9 APN 15 6486656 missense probably benign 0.04
IGL00229:C9 APN 15 6483231 missense possibly damaging 0.68
IGL00647:C9 APN 15 6483083 missense probably benign 0.43
IGL01618:C9 APN 15 6459668 missense probably benign 0.38
IGL02530:C9 APN 15 6497132 missense probably benign
R0267:C9 UTSW 15 6467458 missense probably benign 0.00
R0477:C9 UTSW 15 6458183 missense probably benign 0.25
R0701:C9 UTSW 15 6467421 missense probably damaging 1.00
R0792:C9 UTSW 15 6486762 missense probably damaging 1.00
R0881:C9 UTSW 15 6458868 splice site probably benign
R1281:C9 UTSW 15 6489840 missense possibly damaging 0.80
R1384:C9 UTSW 15 6458934 missense probably benign 0.08
R1522:C9 UTSW 15 6486762 missense probably damaging 1.00
R1988:C9 UTSW 15 6483138 frame shift probably null
R2229:C9 UTSW 15 6445420 missense possibly damaging 0.95
R2406:C9 UTSW 15 6483299 missense possibly damaging 0.76
R3720:C9 UTSW 15 6483119 missense possibly damaging 0.95
R3723:C9 UTSW 15 6483080 missense possibly damaging 0.77
R3929:C9 UTSW 15 6467458 missense probably benign 0.00
R4371:C9 UTSW 15 6491484 missense probably damaging 1.00
R4615:C9 UTSW 15 6491463 missense probably damaging 0.99
R4616:C9 UTSW 15 6491463 missense probably damaging 0.99
R4618:C9 UTSW 15 6491463 missense probably damaging 0.99
R4749:C9 UTSW 15 6489830 missense probably benign 0.19
R4764:C9 UTSW 15 6459643 missense probably damaging 1.00
R5544:C9 UTSW 15 6497027 missense probably damaging 0.99
R5723:C9 UTSW 15 6486816 missense probably damaging 1.00
R5813:C9 UTSW 15 6497126 missense probably benign 0.05
R6735:C9 UTSW 15 6489906 missense probably benign 0.06
R6754:C9 UTSW 15 6489943 nonsense probably null
R6956:C9 UTSW 15 6445464 missense probably benign
R7706:C9 UTSW 15 6458921 missense probably benign 0.08
R7791:C9 UTSW 15 6489878 missense possibly damaging 0.82
R7893:C9 UTSW 15 6483245 missense possibly damaging 0.94
R7977:C9 UTSW 15 6467462 nonsense probably null
R7987:C9 UTSW 15 6467462 nonsense probably null
R8185:C9 UTSW 15 6491397 missense probably damaging 1.00
R9013:C9 UTSW 15 6486712 missense probably damaging 1.00
R9569:C9 UTSW 15 6459581 missense probably damaging 1.00
Z1177:C9 UTSW 15 6491519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACCTTGACACTTAGCCTAAGCC -3'
(R):5'- TGGACCACGGAATGGAATGTCAC -3'

Sequencing Primer
(F):5'- TTAGCCTAAGCCAACACCTATG -3'
(R):5'- GTGAATTTCTCAGCCCATAGAC -3'
Posted On 2013-06-11