Mutagenetix > Incidental Mutations

Incidental Mutation 'R5726:Map4k2'

452533

Institutional Source

Beutler Lab

Gene Symbol

Map4k2

Ensembl Gene

ENSMUSG00000024948

Gene Name

mitogen-activated protein kinase kinase kinase kinase 2

Synonyms

Rab8ip, BL44

MMRRC Submission

043344-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.521) question?

Stock #

R5726 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

6341135-6355615 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 6351332 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 611 (G611C)

Ref Sequence

ENSEMBL: ENSMUSP00000025897 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000124556] [ENSMUST00000142496]

Predicted Effect

probably damaging
Transcript: ENSMUST00000025897
AA Change: G611C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948
AA Change: G611C

Domain	Start	End	E-Value	Type
S_TKc	16	273	2.41e-90	SMART
low complexity region	358	369	N/A	INTRINSIC
low complexity region	425	444	N/A	INTRINSIC
CNH	488	801	1.31e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000113496

Predicted Effect

probably benign
Transcript: ENSMUST00000124556

SMART Domains

Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

Domain	Start	End	E-Value	Type
Pfam:Pkinase	16	56	4e-7	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000128170
AA Change: G65C

SMART Domains

Protein: ENSMUSP00000121856
Gene: ENSMUSG00000024948
AA Change: G65C

Domain	Start	End	E-Value	Type
Pfam:CNH	2	142	3.4e-19	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133696

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137095

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140098

Predicted Effect

probably benign
Transcript: ENSMUST00000142496

SMART Domains

Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

Domain	Start	End	E-Value	Type
Pfam:Pkinase	16	56	4e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142862

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152259

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154900

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155655

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184812

Meta Mutation Damage Score

0.4875

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.6%
20x: 93.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine protein kinase family. Although this kinase is found in many tissues, its expression in lymphoid follicles is restricted to the cells of germinal centre, where it may participate in B-cell differentiation. This kinase can be activated by TNF-alpha, and has been shown to specifically activate MAP kinases. This kinase is also found to interact with TNF receptor-associated factor 2 (TRAF2), which is involved in the activation of MAP3K1/MEKK1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased susceptibility to endotoxin shock. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130023H24Rik	T	C	7: 128,236,660	K254E	probably damaging	Het
Aak1	C	T	6: 86,925,124	Q92*	probably null	Het
Acss3	T	C	10: 107,123,322	T88A	possibly damaging	Het
Adcy4	A	T	14: 55,783,661	S6R	probably damaging	Het
Aldh1l2	T	C	10: 83,512,306	E311G	possibly damaging	Het
Arhgap25	C	T	6: 87,463,459	S402N	probably benign	Het
Btn1a1	T	A	13: 23,459,352	D309V	probably damaging	Het
Cdh23	C	T	10: 60,407,480	V1037M	probably damaging	Het
Clcn2	T	C	16: 20,710,535		probably benign	Het
Cln3	T	C	7: 126,575,501	T276A	probably null	Het
CN725425	A	G	15: 91,260,503	E523G	possibly damaging	Het
Cspg4	A	T	9: 56,885,904	T308S	probably damaging	Het
Dgkh	G	T	14: 78,624,902	F208L	probably benign	Het
Eif2ak4	A	G	2: 118,443,132	D846G	probably damaging	Het
Fmo4	A	G	1: 162,808,259		probably null	Het
Foxp4	A	G	17: 47,869,108	Y623H	unknown	Het
Fxr2	T	C	11: 69,633,346	V10A	probably benign	Het
Gm10271	T	C	10: 116,956,887		probably null	Het
Gsk3b	T	C	16: 38,208,136		probably benign	Het
Ift43	T	A	12: 86,162,183	D169E	probably damaging	Het
Ift57	T	A	16: 49,699,498	L54H	probably damaging	Het
Ighv1-37	T	C	12: 114,896,674		probably benign	Het
Ispd	T	C	12: 36,547,830	V320A	probably damaging	Het
Kl	A	G	5: 150,991,538	N910S	possibly damaging	Het
Lrp2	T	C	2: 69,509,147	D1140G	probably damaging	Het
Map1a	G	A	2: 121,305,065	A1883T	probably damaging	Het
Mical1	A	G	10: 41,483,696		probably benign	Het
Myh14	A	G	7: 44,643,462		probably null	Het
Myh8	T	A	11: 67,294,566	V881D	possibly damaging	Het
Myo1g	G	T	11: 6,509,420	Q817K	probably benign	Het
Nin	A	C	12: 70,078,179	V123G	probably damaging	Het
Nup160	A	G	2: 90,717,851	D976G	probably damaging	Het
Nup210l	A	T	3: 90,129,207		probably null	Het
Olfr262	A	G	19: 12,241,280	I127T	probably damaging	Het
Phf14	T	C	6: 11,933,538		probably benign	Het
Podxl2	T	C	6: 88,848,739	D400G	probably damaging	Het
Pygl	C	T	12: 70,191,142	W707*	probably null	Het
Rnf19b	T	C	4: 129,071,892	V261A	possibly damaging	Het
Rnf213	A	G	11: 119,416,458	Y648C	probably damaging	Het
Scn5a	C	T	9: 119,533,847	R569H	probably damaging	Het
Sdk2	A	G	11: 113,851,800	L761P	probably damaging	Het
Shroom3	C	T	5: 92,943,005	P1124S	probably benign	Het
Sirt4	A	G	5: 115,479,646	V317A	probably benign	Het
Slc12a2	G	T	18: 57,896,354	A271S	probably benign	Het
Slc6a9	A	G	4: 117,864,013	Y208C	probably damaging	Het
Snap23	T	A	2: 120,584,271		probably benign	Het
Sra1	C	T	18: 36,670,173		probably benign	Het
Srbd1	C	T	17: 86,120,729	D359N	possibly damaging	Het
Srp19	A	G	18: 34,331,773	Y22C	probably damaging	Het
Sstr4	T	C	2: 148,396,083	S205P	probably damaging	Het
Sv2b	T	C	7: 75,124,214	D503G	possibly damaging	Het
Tbc1d30	C	T	10: 121,267,574	V518M	probably damaging	Het
Tlr4	A	G	4: 66,840,415	K482E	probably benign	Het
Tpm1	G	A	9: 67,023,412	L310F	probably damaging	Het
Trpm6	A	G	19: 18,853,617	Y1282C	probably damaging	Het
Tsc22d1	T	A	14: 76,505,317	L65*	probably null	Het
Ttc37	T	C	13: 76,118,347	Y238H	probably damaging	Het
Ttc39c	C	A	18: 12,697,935	A284D	probably damaging	Het
Txndc16	G	A	14: 45,165,764	H297Y	probably benign	Het
Utrn	A	T	10: 12,669,806	D1698E	probably benign	Het
Vmn1r232	C	T	17: 20,913,339	R333H	probably benign	Het
Vmn2r14	A	T	5: 109,217,620	D529E	possibly damaging	Het
Vmn2r70	C	T	7: 85,559,107	V721I	probably damaging	Het
Zbtb18	A	G	1: 177,448,553	H484R	probably damaging	Het
Zc3h13	T	A	14: 75,330,829	S1187R	possibly damaging	Het
Zfhx4	T	A	3: 5,403,321	D2846E	probably benign	Het

Other mutations in Map4k2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01607:Map4k2	APN	19	6345593	splice site	probably null
IGL02041:Map4k2	APN	19	6351318	missense	probably benign	0.45
IGL03372:Map4k2	APN	19	6342249	unclassified	probably benign
IGL03380:Map4k2	APN	19	6344590	missense	possibly damaging	0.83
R0968:Map4k2	UTSW	19	6345457	missense	probably damaging	0.98
R1466:Map4k2	UTSW	19	6341917	missense	probably damaging	1.00
R1466:Map4k2	UTSW	19	6341917	missense	probably damaging	1.00
R1612:Map4k2	UTSW	19	6343341	missense	probably damaging	1.00
R2069:Map4k2	UTSW	19	6342738	unclassified	probably benign
R2370:Map4k2	UTSW	19	6341928	nonsense	probably null
R3080:Map4k2	UTSW	19	6353188	missense	probably damaging	0.99
R3825:Map4k2	UTSW	19	6344051	missense	probably benign	0.29
R3896:Map4k2	UTSW	19	6341928	nonsense	probably null
R4088:Map4k2	UTSW	19	6353156	missense	probably damaging	0.99
R4817:Map4k2	UTSW	19	6344429	missense	probably damaging	0.97
R4888:Map4k2	UTSW	19	6344003	missense	probably benign	0.07
R5226:Map4k2	UTSW	19	6346504	unclassified	probably benign
R5544:Map4k2	UTSW	19	6345914	critical splice acceptor site	probably null
R5687:Map4k2	UTSW	19	6345642	unclassified	probably benign
R5688:Map4k2	UTSW	19	6346806	missense	probably damaging	1.00
R5750:Map4k2	UTSW	19	6351337	missense	probably benign	0.15
R5908:Map4k2	UTSW	19	6351316	splice site	probably benign
R6402:Map4k2	UTSW	19	6344081	critical splice donor site	probably null
R6843:Map4k2	UTSW	19	6353447	missense	probably damaging	0.98
R6942:Map4k2	UTSW	19	6346709	missense	possibly damaging	0.95
R7227:Map4k2	UTSW	19	6346594	missense	probably damaging	1.00
R7573:Map4k2	UTSW	19	6344064	missense	probably benign
R7632:Map4k2	UTSW	19	6344054	missense	probably benign
R7893:Map4k2	UTSW	19	6353511	missense	probably damaging	0.98
R8257:Map4k2	UTSW	19	6346000	missense	probably benign	0.00
R8331:Map4k2	UTSW	19	6352823	missense	probably damaging	1.00
R8343:Map4k2	UTSW	19	6346566	missense	probably damaging	1.00
X0010:Map4k2	UTSW	19	6353318	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGATCTTGACCCCTACAGGC -3'
(R):5'- CATGGAACAGGACTCGACAG -3'

Sequencing Primer
(F):5'- TGACCCCTACAGGCGCTTTG -3'
(R):5'- GTGGCAGCTCCTTCCCATCTAG -3'

Posted On

2017-01-03