Incidental Mutation 'R5726:Trpm6'
ID 452535
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Name transient receptor potential cation channel, subfamily M, member 6
Synonyms CHAK2
MMRRC Submission 043344-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5726 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 18749983-18892510 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 18853617 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 1282 (Y1282C)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
AlphaFold Q8CIR4
Predicted Effect probably damaging
Transcript: ENSMUST00000040489
AA Change: Y1282C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: Y1282C

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Meta Mutation Damage Score 0.3683 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130023H24Rik T C 7: 128,236,660 (GRCm38) K254E probably damaging Het
Aak1 C T 6: 86,925,124 (GRCm38) Q92* probably null Het
Acss3 T C 10: 107,123,322 (GRCm38) T88A possibly damaging Het
Adcy4 A T 14: 55,783,661 (GRCm38) S6R probably damaging Het
Aldh1l2 T C 10: 83,512,306 (GRCm38) E311G possibly damaging Het
Arhgap25 C T 6: 87,463,459 (GRCm38) S402N probably benign Het
Btn1a1 T A 13: 23,459,352 (GRCm38) D309V probably damaging Het
Cdh23 C T 10: 60,407,480 (GRCm38) V1037M probably damaging Het
Clcn2 T C 16: 20,710,535 (GRCm38) probably benign Het
Cln3 T C 7: 126,575,501 (GRCm38) T276A probably null Het
CN725425 A G 15: 91,260,503 (GRCm38) E523G possibly damaging Het
Cspg4 A T 9: 56,885,904 (GRCm38) T308S probably damaging Het
Dgkh G T 14: 78,624,902 (GRCm38) F208L probably benign Het
Eif2ak4 A G 2: 118,443,132 (GRCm38) D846G probably damaging Het
Fmo4 A G 1: 162,808,259 (GRCm38) probably null Het
Foxp4 A G 17: 47,869,108 (GRCm38) Y623H unknown Het
Fxr2 T C 11: 69,633,346 (GRCm38) V10A probably benign Het
Gm10271 T C 10: 116,956,887 (GRCm38) probably null Het
Gsk3b T C 16: 38,208,136 (GRCm38) probably benign Het
Ift43 T A 12: 86,162,183 (GRCm38) D169E probably damaging Het
Ift57 T A 16: 49,699,498 (GRCm38) L54H probably damaging Het
Ighv1-37 T C 12: 114,896,674 (GRCm38) probably benign Het
Ispd T C 12: 36,547,830 (GRCm38) V320A probably damaging Het
Kl A G 5: 150,991,538 (GRCm38) N910S possibly damaging Het
Lrp2 T C 2: 69,509,147 (GRCm38) D1140G probably damaging Het
Map1a G A 2: 121,305,065 (GRCm38) A1883T probably damaging Het
Map4k2 G T 19: 6,351,332 (GRCm38) G611C probably damaging Het
Mical1 A G 10: 41,483,696 (GRCm38) probably benign Het
Myh14 A G 7: 44,643,462 (GRCm38) probably null Het
Myh8 T A 11: 67,294,566 (GRCm38) V881D possibly damaging Het
Myo1g G T 11: 6,509,420 (GRCm38) Q817K probably benign Het
Nin A C 12: 70,078,179 (GRCm38) V123G probably damaging Het
Nup160 A G 2: 90,717,851 (GRCm38) D976G probably damaging Het
Nup210l A T 3: 90,129,207 (GRCm38) probably null Het
Olfr262 A G 19: 12,241,280 (GRCm38) I127T probably damaging Het
Phf14 T C 6: 11,933,538 (GRCm38) probably benign Het
Podxl2 T C 6: 88,848,739 (GRCm38) D400G probably damaging Het
Pygl C T 12: 70,191,142 (GRCm38) W707* probably null Het
Rnf19b T C 4: 129,071,892 (GRCm38) V261A possibly damaging Het
Rnf213 A G 11: 119,416,458 (GRCm38) Y648C probably damaging Het
Scn5a C T 9: 119,533,847 (GRCm38) R569H probably damaging Het
Sdk2 A G 11: 113,851,800 (GRCm38) L761P probably damaging Het
Shroom3 C T 5: 92,943,005 (GRCm38) P1124S probably benign Het
Sirt4 A G 5: 115,479,646 (GRCm38) V317A probably benign Het
Slc12a2 G T 18: 57,896,354 (GRCm38) A271S probably benign Het
Slc6a9 A G 4: 117,864,013 (GRCm38) Y208C probably damaging Het
Snap23 T A 2: 120,584,271 (GRCm38) probably benign Het
Sra1 C T 18: 36,670,173 (GRCm38) probably benign Het
Srbd1 C T 17: 86,120,729 (GRCm38) D359N possibly damaging Het
Srp19 A G 18: 34,331,773 (GRCm38) Y22C probably damaging Het
Sstr4 T C 2: 148,396,083 (GRCm38) S205P probably damaging Het
Sv2b T C 7: 75,124,214 (GRCm38) D503G possibly damaging Het
Tbc1d30 C T 10: 121,267,574 (GRCm38) V518M probably damaging Het
Tlr4 A G 4: 66,840,415 (GRCm38) K482E probably benign Het
Tpm1 G A 9: 67,023,412 (GRCm38) L310F probably damaging Het
Tsc22d1 T A 14: 76,505,317 (GRCm38) L65* probably null Het
Ttc37 T C 13: 76,118,347 (GRCm38) Y238H probably damaging Het
Ttc39c C A 18: 12,697,935 (GRCm38) A284D probably damaging Het
Txndc16 G A 14: 45,165,764 (GRCm38) H297Y probably benign Het
Utrn A T 10: 12,669,806 (GRCm38) D1698E probably benign Het
Vmn1r232 C T 17: 20,913,339 (GRCm38) R333H probably benign Het
Vmn2r14 A T 5: 109,217,620 (GRCm38) D529E possibly damaging Het
Vmn2r70 C T 7: 85,559,107 (GRCm38) V721I probably damaging Het
Zbtb18 A G 1: 177,448,553 (GRCm38) H484R probably damaging Het
Zc3h13 T A 14: 75,330,829 (GRCm38) S1187R possibly damaging Het
Zfhx4 T A 3: 5,403,321 (GRCm38) D2846E probably benign Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18,783,908 (GRCm38) splice site probably benign
IGL00862:Trpm6 APN 19 18,827,528 (GRCm38) missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18,877,651 (GRCm38) missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18,825,794 (GRCm38) nonsense probably null
IGL01451:Trpm6 APN 19 18,809,569 (GRCm38) missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18,796,530 (GRCm38) nonsense probably null
IGL01995:Trpm6 APN 19 18,830,327 (GRCm38) splice site probably benign
IGL02092:Trpm6 APN 19 18,772,331 (GRCm38) missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18,832,539 (GRCm38) missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18,854,063 (GRCm38) missense probably benign
IGL02329:Trpm6 APN 19 18,854,217 (GRCm38) missense probably benign 0.17
IGL02366:Trpm6 APN 19 18,778,510 (GRCm38) splice site probably benign
IGL02402:Trpm6 APN 19 18,786,756 (GRCm38) missense probably benign 0.18
IGL02457:Trpm6 APN 19 18,827,398 (GRCm38) nonsense probably null
IGL02457:Trpm6 APN 19 18,825,791 (GRCm38) missense probably damaging 1.00
IGL02684:Trpm6 APN 19 18,802,207 (GRCm38) splice site probably benign
IGL02705:Trpm6 APN 19 18,776,733 (GRCm38) critical splice donor site probably null
IGL02728:Trpm6 APN 19 18,809,652 (GRCm38) missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18,830,012 (GRCm38) splice site probably benign
IGL02818:Trpm6 APN 19 18,866,257 (GRCm38) missense probably benign 0.04
IGL02836:Trpm6 APN 19 18,813,482 (GRCm38) missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18,838,017 (GRCm38) nonsense probably null
IGL03193:Trpm6 APN 19 18,825,872 (GRCm38) missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18,786,779 (GRCm38) missense probably benign 0.12
IGL03227:Trpm6 APN 19 18,819,119 (GRCm38) missense probably benign 0.01
IGL03231:Trpm6 APN 19 18,819,181 (GRCm38) missense probably benign
IGL03245:Trpm6 APN 19 18,877,701 (GRCm38) missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18,838,082 (GRCm38) missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18,813,486 (GRCm38) missense probably benign
P0043:Trpm6 UTSW 19 18,877,765 (GRCm38) missense probably damaging 1.00
PIT4260001:Trpm6 UTSW 19 18,825,802 (GRCm38) missense possibly damaging 0.48
R0057:Trpm6 UTSW 19 18,786,755 (GRCm38) missense probably benign 0.05
R0115:Trpm6 UTSW 19 18,829,952 (GRCm38) missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18,832,593 (GRCm38) missense probably benign 0.05
R0140:Trpm6 UTSW 19 18,819,194 (GRCm38) splice site probably null
R0267:Trpm6 UTSW 19 18,823,378 (GRCm38) missense probably benign
R0350:Trpm6 UTSW 19 18,883,957 (GRCm38) splice site probably null
R0373:Trpm6 UTSW 19 18,853,587 (GRCm38) missense probably benign 0.15
R0393:Trpm6 UTSW 19 18,778,644 (GRCm38) missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18,783,025 (GRCm38) splice site probably benign
R0505:Trpm6 UTSW 19 18,873,902 (GRCm38) splice site probably benign
R0526:Trpm6 UTSW 19 18,792,876 (GRCm38) missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18,872,221 (GRCm38) missense probably benign 0.00
R0609:Trpm6 UTSW 19 18,825,862 (GRCm38) missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18,838,087 (GRCm38) missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18,796,498 (GRCm38) missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18,796,495 (GRCm38) missense probably benign 0.28
R1512:Trpm6 UTSW 19 18,875,931 (GRCm38) missense probably benign
R1558:Trpm6 UTSW 19 18,786,828 (GRCm38) missense probably benign 0.04
R1597:Trpm6 UTSW 19 18,827,524 (GRCm38) missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18,877,631 (GRCm38) missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18,856,217 (GRCm38) missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18,827,567 (GRCm38) missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18,891,999 (GRCm38) splice site probably null
R1840:Trpm6 UTSW 19 18,866,267 (GRCm38) missense probably benign 0.21
R1991:Trpm6 UTSW 19 18,796,284 (GRCm38) missense probably benign 0.00
R2030:Trpm6 UTSW 19 18,854,265 (GRCm38) missense probably benign
R2073:Trpm6 UTSW 19 18,876,042 (GRCm38) missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18,877,739 (GRCm38) missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18,825,752 (GRCm38) missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18,796,284 (GRCm38) missense probably benign 0.00
R2106:Trpm6 UTSW 19 18,813,350 (GRCm38) missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18,829,952 (GRCm38) missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18,792,090 (GRCm38) missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18,854,431 (GRCm38) missense probably benign 0.05
R3719:Trpm6 UTSW 19 18,772,393 (GRCm38) nonsense probably null
R3779:Trpm6 UTSW 19 18,876,039 (GRCm38) missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18,832,557 (GRCm38) missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18,827,525 (GRCm38) missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18,796,500 (GRCm38) missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18,832,477 (GRCm38) missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18,832,597 (GRCm38) missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18,825,872 (GRCm38) missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18,853,791 (GRCm38) missense probably benign 0.01
R4714:Trpm6 UTSW 19 18,854,200 (GRCm38) missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18,876,064 (GRCm38) missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18,813,493 (GRCm38) missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18,867,981 (GRCm38) missense probably benign 0.00
R4814:Trpm6 UTSW 19 18,862,212 (GRCm38) missense probably benign 0.11
R5028:Trpm6 UTSW 19 18,786,760 (GRCm38) missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18,813,464 (GRCm38) missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18,829,933 (GRCm38) missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18,830,207 (GRCm38) missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18,853,604 (GRCm38) missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18,786,819 (GRCm38) missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18,856,175 (GRCm38) missense probably benign 0.04
R5955:Trpm6 UTSW 19 18,892,019 (GRCm38) missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18,853,748 (GRCm38) nonsense probably null
R6105:Trpm6 UTSW 19 18,853,748 (GRCm38) nonsense probably null
R6211:Trpm6 UTSW 19 18,783,128 (GRCm38) missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18,854,291 (GRCm38) missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18,854,108 (GRCm38) missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18,829,990 (GRCm38) missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18,838,042 (GRCm38) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,889,020 (GRCm38) missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18,796,439 (GRCm38) critical splice acceptor site probably null
R6729:Trpm6 UTSW 19 18,830,297 (GRCm38) missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18,877,765 (GRCm38) missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18,783,163 (GRCm38) missense probably benign
R7103:Trpm6 UTSW 19 18,813,547 (GRCm38) missense possibly damaging 0.87
R7126:Trpm6 UTSW 19 18,854,033 (GRCm38) nonsense probably null
R7128:Trpm6 UTSW 19 18,811,773 (GRCm38) missense possibly damaging 0.92
R7157:Trpm6 UTSW 19 18,838,098 (GRCm38) missense possibly damaging 0.91
R7212:Trpm6 UTSW 19 18,853,791 (GRCm38) missense probably benign 0.01
R7263:Trpm6 UTSW 19 18,876,786 (GRCm38) missense probably damaging 1.00
R7268:Trpm6 UTSW 19 18,778,585 (GRCm38) missense probably benign 0.13
R7305:Trpm6 UTSW 19 18,876,091 (GRCm38) missense probably benign 0.30
R7498:Trpm6 UTSW 19 18,876,120 (GRCm38) missense probably damaging 1.00
R7558:Trpm6 UTSW 19 18,778,665 (GRCm38) missense probably damaging 0.96
R7590:Trpm6 UTSW 19 18,832,581 (GRCm38) missense probably benign 0.31
R7646:Trpm6 UTSW 19 18,867,961 (GRCm38) missense probably benign 0.10
R7650:Trpm6 UTSW 19 18,876,013 (GRCm38) missense possibly damaging 0.70
R7727:Trpm6 UTSW 19 18,854,249 (GRCm38) missense probably damaging 0.97
R7743:Trpm6 UTSW 19 18,827,408 (GRCm38) missense probably benign 0.03
R7747:Trpm6 UTSW 19 18,750,045 (GRCm38) splice site probably null
R7807:Trpm6 UTSW 19 18,829,856 (GRCm38) missense probably benign 0.11
R7870:Trpm6 UTSW 19 18,815,241 (GRCm38) missense probably benign 0.01
R7891:Trpm6 UTSW 19 18,776,710 (GRCm38) missense probably benign 0.01
R7955:Trpm6 UTSW 19 18,854,290 (GRCm38) missense probably benign 0.01
R7965:Trpm6 UTSW 19 18,876,110 (GRCm38) missense probably damaging 1.00
R7967:Trpm6 UTSW 19 18,778,659 (GRCm38) missense probably damaging 0.99
R7992:Trpm6 UTSW 19 18,815,350 (GRCm38) missense probably damaging 1.00
R8035:Trpm6 UTSW 19 18,792,862 (GRCm38) missense probably damaging 0.97
R8108:Trpm6 UTSW 19 18,811,790 (GRCm38) missense probably damaging 1.00
R8268:Trpm6 UTSW 19 18,873,861 (GRCm38) missense possibly damaging 0.85
R8411:Trpm6 UTSW 19 18,853,968 (GRCm38) missense probably benign 0.39
R8413:Trpm6 UTSW 19 18,832,485 (GRCm38) missense probably benign 0.00
R8534:Trpm6 UTSW 19 18,892,095 (GRCm38) missense probably benign 0.00
R8932:Trpm6 UTSW 19 18,838,002 (GRCm38) missense possibly damaging 0.87
R8990:Trpm6 UTSW 19 18,815,435 (GRCm38) missense probably damaging 1.00
R9403:Trpm6 UTSW 19 18,832,652 (GRCm38) missense possibly damaging 0.84
R9446:Trpm6 UTSW 19 18,838,098 (GRCm38) missense possibly damaging 0.91
R9463:Trpm6 UTSW 19 18,783,900 (GRCm38) critical splice donor site probably null
R9485:Trpm6 UTSW 19 18,778,614 (GRCm38) missense probably benign 0.06
R9536:Trpm6 UTSW 19 18,786,759 (GRCm38) missense probably damaging 1.00
R9549:Trpm6 UTSW 19 18,876,030 (GRCm38) nonsense probably null
R9564:Trpm6 UTSW 19 18,873,876 (GRCm38) missense possibly damaging 0.92
R9626:Trpm6 UTSW 19 18,813,482 (GRCm38) missense probably damaging 1.00
R9655:Trpm6 UTSW 19 18,892,102 (GRCm38) missense probably benign
R9721:Trpm6 UTSW 19 18,829,972 (GRCm38) missense probably benign 0.12
R9742:Trpm6 UTSW 19 18,823,402 (GRCm38) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAGGACTCCCTACTATCCCTG -3'
(R):5'- AATCCCAGAAGCCGTTGTCC -3'

Sequencing Primer
(F):5'- GGCCATAACTGTTGACACCTTAAAGG -3'
(R):5'- AGAAGCCGTTGTCCTCTGTTC -3'
Posted On 2017-01-03