Mutagenetix > Incidental Mutations

Incidental Mutation 'R5727:Olfr350'

452541

Institutional Source

Beutler Lab

Gene Symbol

Olfr350

Ensembl Gene

ENSMUSG00000050015

Gene Name

olfactory receptor 350

Synonyms

MOR136-13, GA_x6K02T2NLDC-33544602-33545540

MMRRC Submission

043190-MU

Accession Numbers

Genbank: NM_146627; MGI: 3030184

Is this an essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R5727 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36846310-36851702 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36850532 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 162 (L162P)

Ref Sequence

ENSEMBL: ENSMUSP00000149667 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055130] [ENSMUST00000214457] [ENSMUST00000215100]

AlphaFold

Q8VFP8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000055130
AA Change: L162P

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000053105
Gene: ENSMUSG00000050015
AA Change: L162P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	6.3e-61	PFAM
Pfam:7TM_GPCR_Srsx	35	305	1.3e-7	PFAM
Pfam:7tm_1	41	290	3e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000214457
AA Change: L162P

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000215100
AA Change: L162P

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Actr8	C	A	14: 29,990,881	L494M	probably benign	Het
Ahnak	G	T	19: 9,016,747	A5132S	probably damaging	Het
Cadps	G	A	14: 12,486,525	Q882*	probably null	Het
Cdhr2	G	A	13: 54,724,308	V662M	possibly damaging	Het
Cdyl2	T	A	8: 116,583,168	I350F	probably damaging	Het
Cfap44	T	G	16: 44,435,442	F966V	probably damaging	Het
Cpxm1	G	A	2: 130,390,963	R704*	probably null	Het
Dnah11	A	T	12: 118,127,106	F1034L	probably damaging	Het
Dpep2	A	G	8: 105,986,443	V440A	probably benign	Het
Ehmt2	A	T	17: 34,906,032	M11L	possibly damaging	Het
Eml2	C	T	7: 19,190,760	H185Y	probably damaging	Het
Gm10845	T	A	14: 79,863,330		noncoding transcript	Het
Gm8122	T	G	14: 43,234,020	N97T	unknown	Het
Gnb1	A	G	4: 155,555,102	T263A	probably benign	Het
Hyls1	G	A	9: 35,561,184	S312F	probably benign	Het
Ier5l	A	G	2: 30,473,159	C285R	possibly damaging	Het
Kif21b	A	G	1: 136,170,009	N1336D	probably damaging	Het
Kl	A	G	5: 150,991,538	N910S	possibly damaging	Het
Lama1	A	G	17: 67,815,224	H2722R	possibly damaging	Het
Mdm2	A	G	10: 117,702,307	M13T	possibly damaging	Het
Micall1	T	A	15: 79,130,478	Y685N	possibly damaging	Het
Mthfd1l	T	G	10: 4,103,302	S884A	possibly damaging	Het
Nkiras2	A	G	11: 100,625,027	Y60C	probably damaging	Het
Oc90	T	G	15: 65,881,539	R342S	possibly damaging	Het
Olfr1181	T	A	2: 88,423,447	I193F	probably benign	Het
Olfr12	A	G	1: 92,620,178	N91D	probably benign	Het
Olfr1277	T	A	2: 111,269,852	R172*	probably null	Het
Olfr748	C	A	14: 50,710,360	T10K	possibly damaging	Het
Otx1	C	A	11: 21,997,037	A91S	probably damaging	Het
Parp9	G	T	16: 35,964,097	E507*	probably null	Het
Pex13	A	G	11: 23,655,705	I175T	probably benign	Het
Phf12	A	G	11: 78,023,544	E604G	probably damaging	Het
Ppfia4	A	T	1: 134,324,077		probably null	Het
Rragc	T	C	4: 123,920,035	Y141H	possibly damaging	Het
Slc35g3	A	G	11: 69,760,454	V257A	probably benign	Het
Snx5	T	C	2: 144,260,754	T80A	probably benign	Het
Sorcs2	G	A	5: 36,031,286	A826V	possibly damaging	Het
Sptb	G	A	12: 76,623,114	A480V	probably benign	Het
Tmem161b	T	A	13: 84,286,790	S302R	possibly damaging	Het
Ube2o	A	T	11: 116,539,670	F1081I	probably damaging	Het
Vmn2r2	T	C	3: 64,117,187	I658V	probably benign	Het
Vwa3b	T	G	1: 37,135,519	L672V	probably benign	Het
Wscd2	T	C	5: 113,577,350	F417S	possibly damaging	Het

Other mutations in Olfr350

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Olfr350	APN	2	36850270	missense	probably damaging	1.00
IGL01113:Olfr350	APN	2	36850619	missense	probably damaging	1.00
IGL01393:Olfr350	APN	2	36850541	missense	probably benign	0.01
IGL02302:Olfr350	APN	2	36850703	missense	probably benign	0.02
IGL02316:Olfr350	APN	2	36850282	missense	probably damaging	1.00
BB007:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
BB017:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
F6893:Olfr350	UTSW	2	36850807	missense	probably benign	0.00
PIT4402001:Olfr350	UTSW	2	36850304	missense	probably benign
R0312:Olfr350	UTSW	2	36850360	missense	probably benign	0.01
R0525:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R0557:Olfr350	UTSW	2	36850748	missense	possibly damaging	0.95
R0665:Olfr350	UTSW	2	36850190	missense	probably damaging	1.00
R2019:Olfr350	UTSW	2	36850406	missense	possibly damaging	0.95
R2107:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2108:Olfr350	UTSW	2	36850343	missense	possibly damaging	0.54
R2848:Olfr350	UTSW	2	36850799	missense	probably damaging	1.00
R3964:Olfr350	UTSW	2	36850717	missense	probably benign	0.12
R4822:Olfr350	UTSW	2	36850876	missense	probably benign	0.10
R4907:Olfr350	UTSW	2	36850258	missense	probably benign	0.28
R5134:Olfr350	UTSW	2	36850476	missense	probably benign	0.03
R5144:Olfr350	UTSW	2	36850144	missense	probably benign
R5702:Olfr350	UTSW	2	36850934	missense	probably damaging	1.00
R5786:Olfr350	UTSW	2	36850049	start codon destroyed	probably null	0.98
R6179:Olfr350	UTSW	2	36850834	missense	possibly damaging	0.59
R6862:Olfr350	UTSW	2	36850222	missense	possibly damaging	0.95
R7258:Olfr350	UTSW	2	36850340	missense	probably damaging	0.99
R7307:Olfr350	UTSW	2	36850125	missense	probably benign	0.00
R7353:Olfr350	UTSW	2	36850069	missense	probably benign
R7412:Olfr350	UTSW	2	36850466	missense	probably benign	0.28
R7851:Olfr350	UTSW	2	36850416	nonsense	probably null
R7930:Olfr350	UTSW	2	36850273	missense	probably damaging	1.00
R8005:Olfr350	UTSW	2	36850144	missense	probably benign
R8346:Olfr350	UTSW	2	36850339	missense	probably benign	0.02
R8692:Olfr350	UTSW	2	36850084	missense	probably benign	0.00
R9120:Olfr350	UTSW	2	36850131	nonsense	probably null
R9318:Olfr350	UTSW	2	36850553	missense	probably benign	0.12
Z1177:Olfr350	UTSW	2	36850239	missense	probably damaging	0.99
Z1177:Olfr350	UTSW	2	36850925	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCATCCATTCCTTATGCAGAGTG -3'
(R):5'- AATGGTGGCCACAATGTGAC -3'

Sequencing Primer
(F):5'- CCATTCCTTATGCAGAGTGTATAGC -3'
(R):5'- GGCCACAATGTGACCATAAGAGATC -3'

Posted On

2017-01-03