Incidental Mutation 'R5727:Olfr1181'
ID452542
Institutional Source Beutler Lab
Gene Symbol Olfr1181
Ensembl Gene ENSMUSG00000075125
Gene Nameolfactory receptor 1181
SynonymsMOR225-9P, GA_x6K02T2Q125-49911636-49910701
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88420321-88426171 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88423447 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 193 (I193F)
Ref Sequence ENSEMBL: ENSMUSP00000150939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099823] [ENSMUST00000102619] [ENSMUST00000213190] [ENSMUST00000216121] [ENSMUST00000217320]
Predicted Effect probably benign
Transcript: ENSMUST00000099823
AA Change: I193F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000097411
Gene: ENSMUSG00000075125
AA Change: I193F

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 1.5e-48 PFAM
Pfam:7tm_1 39 285 6.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102619
AA Change: I193F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099679
Gene: ENSMUSG00000075125
AA Change: I193F

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
Pfam:7tm_1 39 285 7.2e-26 PFAM
Pfam:7tm_4 137 278 3.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213190
AA Change: I193F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000216121
Predicted Effect probably benign
Transcript: ENSMUST00000217320
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Olfr1181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Olfr1181 APN 2 88423786 missense probably benign 0.30
IGL02224:Olfr1181 APN 2 88423708 splice site probably null
IGL03293:Olfr1181 APN 2 88423227 missense probably damaging 1.00
IGL02802:Olfr1181 UTSW 2 88423488 missense probably benign 0.23
R2214:Olfr1181 UTSW 2 88423117 missense probably benign 0.00
R2508:Olfr1181 UTSW 2 88423456 missense possibly damaging 0.95
R4050:Olfr1181 UTSW 2 88423623 missense probably damaging 0.99
R5404:Olfr1181 UTSW 2 88423801 missense probably damaging 0.98
R6578:Olfr1181 UTSW 2 88423144 missense probably benign 0.12
R6663:Olfr1181 UTSW 2 88423350 missense probably benign 0.25
R6974:Olfr1181 UTSW 2 88423812 missense possibly damaging 0.93
R7042:Olfr1181 UTSW 2 88423402 missense possibly damaging 0.89
R7659:Olfr1181 UTSW 2 88423926 missense probably damaging 1.00
R8443:Olfr1181 UTSW 2 88423401 missense probably benign
X0018:Olfr1181 UTSW 2 88423662 missense probably benign
Z1177:Olfr1181 UTSW 2 88423815 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AAGATTTTGTCTTCAGGGAAAGTGG -3'
(R):5'- TCATGAGCAGAAACAGATGCC -3'

Sequencing Primer
(F):5'- TGTCTTCAGGGAAAGTGGTAGGAG -3'
(R):5'- AACAGATGCCATGTTTTTATCTGGGC -3'
Posted On2017-01-03