Incidental Mutation 'R5727:Snx5'
ID452545
Institutional Source Beutler Lab
Gene Symbol Snx5
Ensembl Gene ENSMUSG00000027423
Gene Namesorting nexin 5
SynonymsD2Ertd52e, 0910001N05Rik, 1810032P22Rik
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location144250123-144270906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144260754 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000105657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028909] [ENSMUST00000110030]
Predicted Effect probably benign
Transcript: ENSMUST00000028909
AA Change: T80A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028909
Gene: ENSMUSG00000027423
AA Change: T80A

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 6.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083791
Predicted Effect probably benign
Transcript: ENSMUST00000110030
AA Change: T80A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105657
Gene: ENSMUSG00000027423
AA Change: T80A

DomainStartEndE-ValueType
PX 31 169 1.85e-2 SMART
Pfam:Vps5 179 398 1.7e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153033
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sorting nexin family. Members of this family contain a phox (PX) domain, which is a phosphoinositide binding domain, and are involved in intracellular trafficking. This protein functions in endosomal sorting, the phosphoinositide-signaling pathway, and macropinocytosis. This gene may play a role in the tumorigenesis of papillary thyroid carcinoma. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired alveolar epithelial differentiation of type I cells, respiratory failure and lethality during the perinatal and postnatal periods. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Snx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Snx5 APN 2 144255565 missense probably benign
IGL01739:Snx5 APN 2 144270405 missense probably benign 0.00
IGL03394:Snx5 APN 2 144253754 missense probably damaging 1.00
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0052:Snx5 UTSW 2 144259192 splice site probably null
R0344:Snx5 UTSW 2 144257208 splice site probably benign
R0848:Snx5 UTSW 2 144253806 missense probably damaging 0.98
R1440:Snx5 UTSW 2 144254811 missense possibly damaging 0.90
R2282:Snx5 UTSW 2 144253675 missense probably benign 0.03
R3830:Snx5 UTSW 2 144254901 critical splice donor site probably null
R6048:Snx5 UTSW 2 144259153 missense probably damaging 0.97
R7497:Snx5 UTSW 2 144257974 missense probably damaging 0.99
Z1088:Snx5 UTSW 2 144252491 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CTGTGAATTCCATCTCCAGGGG -3'
(R):5'- AAGTTGCCTAGGTTAGTGGC -3'

Sequencing Primer
(F):5'- GAATTCCATCTCCAGGGGATCTGAC -3'
(R):5'- GCCTAGGTTAGTGGCTTTAGATC -3'
Posted On2017-01-03