Incidental Mutation 'R5727:Sorcs2'
ID452552
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Namesortilin-related VPS10 domain containing receptor 2
SynonymsVPS10 domain receptor protein
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location36017180-36398139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36031286 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 826 (A826V)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: A826V

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: A826V

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Nkiras2 A G 11: 100,625,027 Y60C probably damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36037401 splice site probably null
IGL01064:Sorcs2 APN 5 36065352 missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36021252 missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36047809 missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36025942 missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36062552 missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36077957 missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36068148 missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36065331 unclassified probably benign
IGL03141:Sorcs2 APN 5 36065355 missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36031212 missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36046504 missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36153845 missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36397553 splice site probably benign
R0345:Sorcs2 UTSW 5 36027874 missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36031190 missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36065433 missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36024572 missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36027925 missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36026748 missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36229220 splice site probably benign
R1935:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36071387 missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36042086 splice site probably null
R3148:Sorcs2 UTSW 5 36035788 missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36397806 missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36397663 nonsense probably null
R4092:Sorcs2 UTSW 5 36025822 missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36037494 missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36043452 missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36039390 missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36031183 missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36046530 nonsense probably null
R5874:Sorcs2 UTSW 5 36229211 missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36229191 missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36029083 missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36019384 missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36027988 splice site probably null
R6290:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36062587 missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36077966 missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36397810 missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36021261 missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36068130 missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36025876 missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36027978 missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36397952 missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36043527 missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36229175 missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36024072 missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36024614 missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36062614 missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36062588 missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36038206 missense probably benign 0.00
RF063:Sorcs2 UTSW 5 36153811 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAAGATTCCCTGTGCTCC -3'
(R):5'- GAGACAACCTACTCTCTGGC -3'

Sequencing Primer
(F):5'- CTCTTAATTTCAAGAGGAGCCAC -3'
(R):5'- TACTCTCTGGCCTCAAAGAGC -3'
Posted On2017-01-03