Incidental Mutation 'R5727:Sorcs2'
ID 452552
Institutional Source Beutler Lab
Gene Symbol Sorcs2
Ensembl Gene ENSMUSG00000029093
Gene Name sortilin-related VPS10 domain containing receptor 2
Synonyms VPS10 domain receptor protein
MMRRC Submission 043190-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5727 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 36174524-36555483 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 36188630 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 826 (A826V)
Ref Sequence ENSEMBL: ENSMUSP00000041828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370]
AlphaFold Q9EPR5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037370
AA Change: A826V

PolyPhen 2 Score 0.520 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093
AA Change: A826V

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to reduced dopamine levels and dopamine metabolism, dopaminergic hyperinnervation of the frontal cortex, hyperactivity, abnormal behavioral response to amphetamine, and decreased induction of Schwann cell apoptosis following sciatic nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,712,838 (GRCm39) L494M probably benign Het
Ahnak G T 19: 8,994,111 (GRCm39) A5132S probably damaging Het
Cadps G A 14: 12,486,525 (GRCm38) Q882* probably null Het
Cdhr2 G A 13: 54,872,121 (GRCm39) V662M possibly damaging Het
Cdyl2 T A 8: 117,309,907 (GRCm39) I350F probably damaging Het
Cfap44 T G 16: 44,255,805 (GRCm39) F966V probably damaging Het
Cpxm1 G A 2: 130,232,883 (GRCm39) R704* probably null Het
Dnah11 A T 12: 118,090,841 (GRCm39) F1034L probably damaging Het
Dpep2 A G 8: 106,713,075 (GRCm39) V440A probably benign Het
Ehmt2 A T 17: 35,125,008 (GRCm39) M11L possibly damaging Het
Eml2 C T 7: 18,924,685 (GRCm39) H185Y probably damaging Het
Gm10845 T A 14: 80,100,770 (GRCm39) noncoding transcript Het
Gm8122 T G 14: 43,091,477 (GRCm39) N97T unknown Het
Gnb1 A G 4: 155,639,559 (GRCm39) T263A probably benign Het
Hyls1 G A 9: 35,472,480 (GRCm39) S312F probably benign Het
Ier5l A G 2: 30,363,171 (GRCm39) C285R possibly damaging Het
Kif21b A G 1: 136,097,747 (GRCm39) N1336D probably damaging Het
Kl A G 5: 150,915,003 (GRCm39) N910S possibly damaging Het
Lama1 A G 17: 68,122,219 (GRCm39) H2722R possibly damaging Het
Mdm2 A G 10: 117,538,212 (GRCm39) M13T possibly damaging Het
Micall1 T A 15: 79,014,678 (GRCm39) Y685N possibly damaging Het
Mthfd1l T G 10: 4,053,302 (GRCm39) S884A possibly damaging Het
Nkiras2 A G 11: 100,515,853 (GRCm39) Y60C probably damaging Het
Oc90 T G 15: 65,753,388 (GRCm39) R342S possibly damaging Het
Or11h23 C A 14: 50,947,817 (GRCm39) T10K possibly damaging Het
Or1j4 T C 2: 36,740,544 (GRCm39) L162P possibly damaging Het
Or4k35 T A 2: 111,100,197 (GRCm39) R172* probably null Het
Or4p20 T A 2: 88,253,791 (GRCm39) I193F probably benign Het
Or9s13 A G 1: 92,547,900 (GRCm39) N91D probably benign Het
Otx1 C A 11: 21,947,037 (GRCm39) A91S probably damaging Het
Parp9 G T 16: 35,784,467 (GRCm39) E507* probably null Het
Pex13 A G 11: 23,605,705 (GRCm39) I175T probably benign Het
Phf12 A G 11: 77,914,370 (GRCm39) E604G probably damaging Het
Ppfia4 A T 1: 134,251,815 (GRCm39) probably null Het
Rragc T C 4: 123,813,828 (GRCm39) Y141H possibly damaging Het
Slc35g3 A G 11: 69,651,280 (GRCm39) V257A probably benign Het
Snx5 T C 2: 144,102,674 (GRCm39) T80A probably benign Het
Sptb G A 12: 76,669,888 (GRCm39) A480V probably benign Het
Tmem161b T A 13: 84,434,909 (GRCm39) S302R possibly damaging Het
Ube2o A T 11: 116,430,496 (GRCm39) F1081I probably damaging Het
Vmn2r2 T C 3: 64,024,608 (GRCm39) I658V probably benign Het
Vwa3b T G 1: 37,174,600 (GRCm39) L672V probably benign Het
Wscd2 T C 5: 113,715,411 (GRCm39) F417S possibly damaging Het
Other mutations in Sorcs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Sorcs2 APN 5 36,194,745 (GRCm39) splice site probably null
IGL01064:Sorcs2 APN 5 36,222,696 (GRCm39) missense probably damaging 1.00
IGL01120:Sorcs2 APN 5 36,178,596 (GRCm39) missense probably damaging 0.99
IGL01730:Sorcs2 APN 5 36,205,153 (GRCm39) missense probably damaging 1.00
IGL02542:Sorcs2 APN 5 36,183,286 (GRCm39) missense probably damaging 0.98
IGL02730:Sorcs2 APN 5 36,219,896 (GRCm39) missense probably benign 0.11
IGL02965:Sorcs2 APN 5 36,235,301 (GRCm39) missense probably benign 0.13
IGL02997:Sorcs2 APN 5 36,225,492 (GRCm39) missense probably damaging 1.00
IGL03000:Sorcs2 APN 5 36,222,675 (GRCm39) unclassified probably benign
IGL03141:Sorcs2 APN 5 36,222,699 (GRCm39) missense probably benign 0.01
IGL03184:Sorcs2 APN 5 36,188,556 (GRCm39) missense probably benign 0.01
IGL03412:Sorcs2 APN 5 36,203,848 (GRCm39) missense probably damaging 1.00
R0180:Sorcs2 UTSW 5 36,311,189 (GRCm39) missense probably damaging 1.00
R0244:Sorcs2 UTSW 5 36,554,897 (GRCm39) splice site probably benign
R0345:Sorcs2 UTSW 5 36,185,218 (GRCm39) missense probably benign 0.01
R0519:Sorcs2 UTSW 5 36,188,534 (GRCm39) missense probably benign 0.08
R0624:Sorcs2 UTSW 5 36,222,777 (GRCm39) missense probably damaging 0.97
R0625:Sorcs2 UTSW 5 36,181,916 (GRCm39) missense possibly damaging 0.65
R1169:Sorcs2 UTSW 5 36,185,269 (GRCm39) missense possibly damaging 0.70
R1721:Sorcs2 UTSW 5 36,184,092 (GRCm39) missense probably damaging 0.98
R1809:Sorcs2 UTSW 5 36,386,564 (GRCm39) splice site probably benign
R1935:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R1936:Sorcs2 UTSW 5 36,228,731 (GRCm39) missense possibly damaging 0.88
R2279:Sorcs2 UTSW 5 36,199,430 (GRCm39) splice site probably null
R3148:Sorcs2 UTSW 5 36,193,132 (GRCm39) missense probably benign 0.09
R3803:Sorcs2 UTSW 5 36,555,150 (GRCm39) missense probably benign 0.36
R3863:Sorcs2 UTSW 5 36,555,007 (GRCm39) nonsense probably null
R4092:Sorcs2 UTSW 5 36,183,166 (GRCm39) missense possibly damaging 0.92
R4620:Sorcs2 UTSW 5 36,194,838 (GRCm39) missense probably benign 0.00
R5079:Sorcs2 UTSW 5 36,200,796 (GRCm39) missense probably damaging 1.00
R5301:Sorcs2 UTSW 5 36,196,734 (GRCm39) missense probably damaging 1.00
R5470:Sorcs2 UTSW 5 36,188,527 (GRCm39) missense probably benign 0.00
R5568:Sorcs2 UTSW 5 36,203,874 (GRCm39) nonsense probably null
R5874:Sorcs2 UTSW 5 36,386,555 (GRCm39) missense probably damaging 1.00
R5890:Sorcs2 UTSW 5 36,386,535 (GRCm39) missense probably damaging 1.00
R5946:Sorcs2 UTSW 5 36,186,427 (GRCm39) missense probably damaging 1.00
R6005:Sorcs2 UTSW 5 36,176,728 (GRCm39) missense probably damaging 1.00
R6048:Sorcs2 UTSW 5 36,185,332 (GRCm39) splice site probably null
R6290:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6292:Sorcs2 UTSW 5 36,219,931 (GRCm39) missense probably damaging 1.00
R6617:Sorcs2 UTSW 5 36,235,310 (GRCm39) missense probably damaging 1.00
R6681:Sorcs2 UTSW 5 36,555,154 (GRCm39) missense probably benign 0.00
R7024:Sorcs2 UTSW 5 36,178,605 (GRCm39) missense probably damaging 0.99
R7056:Sorcs2 UTSW 5 36,225,474 (GRCm39) missense probably damaging 1.00
R7569:Sorcs2 UTSW 5 36,183,220 (GRCm39) missense probably benign 0.01
R7641:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7651:Sorcs2 UTSW 5 36,185,322 (GRCm39) missense probably damaging 1.00
R7674:Sorcs2 UTSW 5 36,555,296 (GRCm39) missense probably damaging 0.99
R7722:Sorcs2 UTSW 5 36,200,871 (GRCm39) missense probably damaging 1.00
R7748:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R7764:Sorcs2 UTSW 5 36,181,416 (GRCm39) missense possibly damaging 0.48
R7813:Sorcs2 UTSW 5 36,181,958 (GRCm39) missense probably damaging 1.00
R8142:Sorcs2 UTSW 5 36,219,958 (GRCm39) missense possibly damaging 0.67
R8246:Sorcs2 UTSW 5 36,219,932 (GRCm39) missense probably damaging 1.00
R8254:Sorcs2 UTSW 5 36,195,550 (GRCm39) missense probably benign 0.00
R8349:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8350:Sorcs2 UTSW 5 36,311,207 (GRCm39) missense probably damaging 0.96
R8354:Sorcs2 UTSW 5 36,222,753 (GRCm39) missense probably benign 0.01
R8449:Sorcs2 UTSW 5 36,386,519 (GRCm39) missense possibly damaging 0.56
R8679:Sorcs2 UTSW 5 36,196,657 (GRCm39) missense probably benign 0.09
R8771:Sorcs2 UTSW 5 36,188,624 (GRCm39) missense probably damaging 1.00
R8935:Sorcs2 UTSW 5 36,193,202 (GRCm39) missense possibly damaging 0.79
R8964:Sorcs2 UTSW 5 36,386,511 (GRCm39) missense possibly damaging 0.85
R9164:Sorcs2 UTSW 5 36,235,312 (GRCm39) missense possibly damaging 0.94
R9221:Sorcs2 UTSW 5 36,181,910 (GRCm39) critical splice donor site probably null
R9290:Sorcs2 UTSW 5 36,183,225 (GRCm39) missense probably damaging 0.96
R9358:Sorcs2 UTSW 5 36,200,814 (GRCm39) missense probably damaging 1.00
R9492:Sorcs2 UTSW 5 36,186,484 (GRCm39) missense probably benign 0.08
R9493:Sorcs2 UTSW 5 36,199,529 (GRCm39) missense possibly damaging 0.61
R9640:Sorcs2 UTSW 5 36,222,765 (GRCm39) nonsense probably null
RF063:Sorcs2 UTSW 5 36,311,155 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAAGATTCCCTGTGCTCC -3'
(R):5'- GAGACAACCTACTCTCTGGC -3'

Sequencing Primer
(F):5'- CTCTTAATTTCAAGAGGAGCCAC -3'
(R):5'- TACTCTCTGGCCTCAAAGAGC -3'
Posted On 2017-01-03