Incidental Mutation 'R0552:Muc20'
ID45256
Institutional Source Beutler Lab
Gene Symbol Muc20
Ensembl Gene ENSMUSG00000035638
Gene Namemucin 20
Synonyms
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location32777419-32797435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32793930 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 359 (A359V)
Ref Sequence ENSEMBL: ENSMUSP00000110769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041123] [ENSMUST00000115116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041123
AA Change: A359V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041221
Gene: ENSMUSG00000035638
AA Change: A359V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 3.3e-8 PROSPERO
internal_repeat_1 138 170 3.3e-8 PROSPERO
internal_repeat_2 144 161 5.26e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 5.26e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115116
AA Change: A359V

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110769
Gene: ENSMUSG00000035638
AA Change: A359V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
internal_repeat_1 114 146 2.16e-8 PROSPERO
internal_repeat_1 138 170 2.16e-8 PROSPERO
internal_repeat_2 144 161 4e-5 PROSPERO
low complexity region 171 204 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 228 245 4e-5 PROSPERO
low complexity region 324 351 N/A INTRINSIC
low complexity region 376 385 N/A INTRINSIC
low complexity region 516 550 N/A INTRINSIC
low complexity region 574 593 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins secreted by many epithelial tissues to form an insoluble mucous barrier. The C-terminus of this family member associates with the multifunctional docking site of the MET proto-oncogene and suppresses activation of some downstream MET signaling cascades. The protein features a mucin tandem repeat domain that varies between two and six copies in most individuals. Multiple variants encoding different isoforms have been found for this gene. A related pseudogene, which is also located on chromosome 3, has been identified. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Zfp563 A T 17: 33,104,685 S85C possibly damaging Het
Other mutations in Muc20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Muc20 APN 16 32793703 missense probably benign 0.10
IGL02016:Muc20 APN 16 32797352 missense possibly damaging 0.46
IGL02092:Muc20 APN 16 32794272 missense probably damaging 0.99
IGL02415:Muc20 APN 16 32794681 missense unknown
R6669_muc20_072 UTSW 16 32793937 missense possibly damaging 0.94
R0629:Muc20 UTSW 16 32793421 missense possibly damaging 0.66
R0669:Muc20 UTSW 16 32794480 missense unknown
R0725:Muc20 UTSW 16 32793488 missense probably benign 0.05
R1676:Muc20 UTSW 16 32794279 missense probably damaging 1.00
R1771:Muc20 UTSW 16 32793852 missense probably damaging 0.97
R1778:Muc20 UTSW 16 32794141 missense possibly damaging 0.49
R1967:Muc20 UTSW 16 32794242 missense probably benign 0.03
R2104:Muc20 UTSW 16 32794177 missense probably damaging 0.99
R3054:Muc20 UTSW 16 32779029 missense probably benign 0.18
R4704:Muc20 UTSW 16 32779074 missense possibly damaging 0.70
R4893:Muc20 UTSW 16 32794672 missense possibly damaging 0.66
R4986:Muc20 UTSW 16 32777635 intron probably benign
R5191:Muc20 UTSW 16 32794476 missense unknown
R5195:Muc20 UTSW 16 32794476 missense unknown
R5875:Muc20 UTSW 16 32793819 missense possibly damaging 0.93
R5931:Muc20 UTSW 16 32794574 missense possibly damaging 0.81
R6434:Muc20 UTSW 16 32794806 missense probably benign 0.01
R6523:Muc20 UTSW 16 32793450 missense possibly damaging 0.90
R6580:Muc20 UTSW 16 32793489 missense possibly damaging 0.77
R6669:Muc20 UTSW 16 32793937 missense possibly damaging 0.94
R7028:Muc20 UTSW 16 32794246 missense probably benign 0.03
R7681:Muc20 UTSW 16 32793619 missense probably benign 0.34
R7722:Muc20 UTSW 16 32797386 missense probably benign 0.00
R8678:Muc20 UTSW 16 32797419 start gained probably benign
R8730:Muc20 UTSW 16 32779116 missense probably benign 0.03
R8838:Muc20 UTSW 16 32793459 missense possibly damaging 0.64
W0251:Muc20 UTSW 16 32793853 missense possibly damaging 0.91
X0011:Muc20 UTSW 16 32793252 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AACTGTCACCGAAGTTCCAACAGAG -3'
(R):5'- TGAGCACTGTCCAAACTGGCAC -3'

Sequencing Primer
(F):5'- TAGTGGAGACTGTCCCCTCAAG -3'
(R):5'- GACTCCATAGAAGCCGTCTTTG -3'
Posted On2013-06-11