Incidental Mutation 'R5727:Nkiras2'
ID452566
Institutional Source Beutler Lab
Gene Symbol Nkiras2
Ensembl Gene ENSMUSG00000017837
Gene NameNFKB inhibitor interacting Ras-like protein 2
SynonymsKBRAS2, 4930527H08Rik, 2410003M04Rik
MMRRC Submission 043190-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5727 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100619244-100627607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100625027 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000114456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014339] [ENSMUST00000017981] [ENSMUST00000051947] [ENSMUST00000103119] [ENSMUST00000107376] [ENSMUST00000142993]
Predicted Effect probably benign
Transcript: ENSMUST00000014339
SMART Domains Protein: ENSMUSP00000014339
Gene: ENSMUSG00000014195

DomainStartEndE-ValueType
TPR 28 61 3.39e-7 SMART
TPR 62 95 1.11e-2 SMART
TPR 96 129 4.09e-1 SMART
Blast:TPR 142 175 4e-13 BLAST
Blast:TPR 176 209 1e-13 BLAST
TPR 210 243 2.29e-4 SMART
TPR 256 289 1.11e-2 SMART
TPR 294 327 2.87e-5 SMART
TPR 328 361 1.83e-3 SMART
DnaJ 380 443 2.93e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000017981
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017981
Gene: ENSMUSG00000017837
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:Arf 1 168 4.3e-9 PFAM
Pfam:Roc 6 124 2.2e-13 PFAM
Pfam:MMR_HSR1 6 165 3.1e-6 PFAM
Pfam:Ras 6 170 2.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000051947
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059559
Gene: ENSMUSG00000017837
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:Arf 1 168 5.6e-9 PFAM
Pfam:Miro 6 123 2.2e-21 PFAM
Pfam:Ras 6 170 4.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103119
SMART Domains Protein: ENSMUSP00000099408
Gene: ENSMUSG00000014198

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
ZnF_U1 72 108 4.36e-2 SMART
ZnF_C2H2 77 99 1.51e0 SMART
low complexity region 125 141 N/A INTRINSIC
low complexity region 143 161 N/A INTRINSIC
low complexity region 181 200 N/A INTRINSIC
ZnF_U1 225 259 5.72e-4 SMART
ZnF_C2H2 228 252 7.11e0 SMART
ZnF_U1 294 328 7.44e-3 SMART
ZnF_C2H2 297 321 4.34e0 SMART
low complexity region 347 365 N/A INTRINSIC
low complexity region 382 405 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107376
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102999
Gene: ENSMUSG00000017837
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:Arf 1 168 5.6e-9 PFAM
Pfam:Miro 6 123 2.2e-21 PFAM
Pfam:Ras 6 170 4.5e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127547
Predicted Effect probably damaging
Transcript: ENSMUST00000142993
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114456
Gene: ENSMUSG00000017837
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:Arf 1 151 1.3e-8 PFAM
Pfam:Miro 6 123 1.4e-21 PFAM
Pfam:MMR_HSR1 6 145 4.5e-6 PFAM
Pfam:Ras 6 153 2.9e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155840
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 C A 14: 29,990,881 L494M probably benign Het
Ahnak G T 19: 9,016,747 A5132S probably damaging Het
Cadps G A 14: 12,486,525 Q882* probably null Het
Cdhr2 G A 13: 54,724,308 V662M possibly damaging Het
Cdyl2 T A 8: 116,583,168 I350F probably damaging Het
Cfap44 T G 16: 44,435,442 F966V probably damaging Het
Cpxm1 G A 2: 130,390,963 R704* probably null Het
Dnah11 A T 12: 118,127,106 F1034L probably damaging Het
Dpep2 A G 8: 105,986,443 V440A probably benign Het
Ehmt2 A T 17: 34,906,032 M11L possibly damaging Het
Eml2 C T 7: 19,190,760 H185Y probably damaging Het
Gm10845 T A 14: 79,863,330 noncoding transcript Het
Gm8122 T G 14: 43,234,020 N97T unknown Het
Gnb1 A G 4: 155,555,102 T263A probably benign Het
Hyls1 G A 9: 35,561,184 S312F probably benign Het
Ier5l A G 2: 30,473,159 C285R possibly damaging Het
Kif21b A G 1: 136,170,009 N1336D probably damaging Het
Kl A G 5: 150,991,538 N910S possibly damaging Het
Lama1 A G 17: 67,815,224 H2722R possibly damaging Het
Mdm2 A G 10: 117,702,307 M13T possibly damaging Het
Micall1 T A 15: 79,130,478 Y685N possibly damaging Het
Mthfd1l T G 10: 4,103,302 S884A possibly damaging Het
Oc90 T G 15: 65,881,539 R342S possibly damaging Het
Olfr1181 T A 2: 88,423,447 I193F probably benign Het
Olfr12 A G 1: 92,620,178 N91D probably benign Het
Olfr1277 T A 2: 111,269,852 R172* probably null Het
Olfr350 T C 2: 36,850,532 L162P possibly damaging Het
Olfr748 C A 14: 50,710,360 T10K possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Parp9 G T 16: 35,964,097 E507* probably null Het
Pex13 A G 11: 23,655,705 I175T probably benign Het
Phf12 A G 11: 78,023,544 E604G probably damaging Het
Ppfia4 A T 1: 134,324,077 probably null Het
Rragc T C 4: 123,920,035 Y141H possibly damaging Het
Slc35g3 A G 11: 69,760,454 V257A probably benign Het
Snx5 T C 2: 144,260,754 T80A probably benign Het
Sorcs2 G A 5: 36,031,286 A826V possibly damaging Het
Sptb G A 12: 76,623,114 A480V probably benign Het
Tmem161b T A 13: 84,286,790 S302R possibly damaging Het
Ube2o A T 11: 116,539,670 F1081I probably damaging Het
Vmn2r2 T C 3: 64,117,187 I658V probably benign Het
Vwa3b T G 1: 37,135,519 L672V probably benign Het
Wscd2 T C 5: 113,577,350 F417S possibly damaging Het
Other mutations in Nkiras2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Nkiras2 APN 11 100624982 missense probably damaging 0.97
IGL03080:Nkiras2 APN 11 100624279 unclassified probably null
R0543:Nkiras2 UTSW 11 100624192 unclassified probably benign
R0733:Nkiras2 UTSW 11 100624932 unclassified probably null
R1192:Nkiras2 UTSW 11 100625980 unclassified probably null
R1698:Nkiras2 UTSW 11 100625163 missense probably damaging 1.00
R5973:Nkiras2 UTSW 11 100626040 missense probably damaging 0.99
R6427:Nkiras2 UTSW 11 100625035 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGATAAAGACATGACACTCGG -3'
(R):5'- GCAGAAGTCTAGGACATGTACC -3'

Sequencing Primer
(F):5'- AAGTCTGGTCTCTCCCGAG -3'
(R):5'- AGAAGTCTAGGACATGTACCTCCTTC -3'
Posted On2017-01-03