Incidental Mutation 'R5728:Wrap73'
ID 452598
Institutional Source Beutler Lab
Gene Symbol Wrap73
Ensembl Gene ENSMUSG00000029029
Gene Name WD repeat containing, antisense to Trp73
Synonyms DD57, Wdr8, 5330425N03Rik, 2610044M17Rik
MMRRC Submission 043345-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.754) question?
Stock # R5728 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 154142372-154167420 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 154154642 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030895] [ENSMUST00000030896] [ENSMUST00000105639]
AlphaFold Q9JM98
Predicted Effect probably null
Transcript: ENSMUST00000030895
SMART Domains Protein: ENSMUSP00000030895
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
Blast:WD40 38 77 4e-18 BLAST
Blast:WD40 81 120 6e-16 BLAST
Blast:WD40 125 163 9e-6 BLAST
WD40 167 208 2.28e2 SMART
WD40 215 251 1.58e-2 SMART
WD40 319 360 2.29e1 SMART
WD40 363 401 4.18e-2 SMART
Blast:WD40 402 443 2e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000030896
SMART Domains Protein: ENSMUSP00000030896
Gene: ENSMUSG00000029030

DomainStartEndE-ValueType
Pfam:hSac2 56 163 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105639
SMART Domains Protein: ENSMUSP00000101264
Gene: ENSMUSG00000029030

DomainStartEndE-ValueType
Pfam:hSac2 53 106 6.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132562
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136374
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142665
Predicted Effect probably null
Transcript: ENSMUST00000146734
SMART Domains Protein: ENSMUSP00000118548
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
WD40 28 64 1.58e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146734
SMART Domains Protein: ENSMUSP00000118548
Gene: ENSMUSG00000029029

DomainStartEndE-ValueType
WD40 28 64 1.58e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Studies of the related mouse protein suggest that the encoded protein may play a role in the process of ossification. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik T A 2: 104,122,868 M13K possibly damaging Het
Abca13 T A 11: 9,570,576 V4493D probably damaging Het
Ank1 A G 8: 23,122,767 probably null Het
B4galnt4 A G 7: 141,070,575 D785G probably benign Het
Chtop C T 3: 90,500,092 G187D probably damaging Het
Cnih1 A G 14: 46,780,191 F78S probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcun1d4 T C 5: 73,520,148 F57L possibly damaging Het
Dgkz A G 2: 91,945,787 S44P possibly damaging Het
Dhps A G 8: 85,073,335 D138G probably damaging Het
Elp2 A G 18: 24,617,452 E282G probably damaging Het
Exoc6b T C 6: 84,860,191 Y342C probably damaging Het
Fasn A C 11: 120,813,513 S1386A probably benign Het
Foxj3 A T 4: 119,573,762 N111Y probably damaging Het
Gm5431 T C 11: 48,888,613 E772G probably damaging Het
Gpbar1 A G 1: 74,279,057 N153S probably damaging Het
Hspg2 T C 4: 137,542,766 I2345T possibly damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Lce1f A G 3: 92,719,345 S2P unknown Het
Lrrk2 A G 15: 91,774,974 D1863G probably benign Het
Lurap1 T C 4: 116,144,388 E36G possibly damaging Het
Lysmd3 A G 13: 81,669,261 E119G probably damaging Het
Map9 G A 3: 82,363,335 V69I probably benign Het
Mfsd4b2 A C 10: 39,923,795 F37C possibly damaging Het
Moxd1 A T 10: 24,223,683 H27L possibly damaging Het
Myo15 A T 11: 60,488,896 K1476N probably damaging Het
Mzf1 A G 7: 13,044,058 I552T probably benign Het
Nfatc2 A G 2: 168,480,249 V910A probably benign Het
Olfr666 C T 7: 104,893,229 R133Q possibly damaging Het
Prss2 T C 6: 41,523,917 V88A probably benign Het
Rhbdf1 A G 11: 32,209,901 probably null Het
Slc10a4 A T 5: 73,012,334 Q434L probably damaging Het
Slc4a3 A G 1: 75,549,840 T2A probably benign Het
Sqor A G 2: 122,809,400 *194W probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tagap1 A G 17: 6,957,021 V92A probably benign Het
Tiam2 A G 17: 3,414,956 Y320C probably damaging Het
Toporsl T C 4: 52,611,469 I454T probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ubap1l T C 9: 65,369,288 V24A probably benign Het
Unc13c A T 9: 73,558,956 S1810T probably benign Het
Vmn1r56 A T 7: 5,196,123 I165K probably benign Het
Wnt8b A G 19: 44,511,318 T169A possibly damaging Het
Wwc2 A G 8: 47,864,061 I703T unknown Het
Zfp354a T A 11: 51,070,605 C546S probably damaging Het
Other mutations in Wrap73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Wrap73 APN 4 154152639 missense probably damaging 0.99
IGL01562:Wrap73 APN 4 154145337 missense possibly damaging 0.63
IGL01863:Wrap73 APN 4 154145333 missense probably benign 0.02
IGL02342:Wrap73 APN 4 154148780 missense probably benign 0.36
IGL03012:Wrap73 APN 4 154145234 splice site probably benign
IGL03303:Wrap73 APN 4 154146543 missense probably damaging 0.98
R0128:Wrap73 UTSW 4 154142500 missense possibly damaging 0.81
R0455:Wrap73 UTSW 4 154148743 missense possibly damaging 0.63
R0524:Wrap73 UTSW 4 154145307 missense probably damaging 1.00
R0528:Wrap73 UTSW 4 154145319 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154151649 missense probably damaging 1.00
R0533:Wrap73 UTSW 4 154156154 missense possibly damaging 0.91
R0633:Wrap73 UTSW 4 154142491 missense probably damaging 0.98
R1118:Wrap73 UTSW 4 154152427 splice site probably null
R1669:Wrap73 UTSW 4 154156131 missense probably damaging 0.99
R1725:Wrap73 UTSW 4 154148752 missense possibly damaging 0.73
R2070:Wrap73 UTSW 4 154148743 missense possibly damaging 0.63
R4530:Wrap73 UTSW 4 154156707 unclassified probably benign
R4669:Wrap73 UTSW 4 154151696 missense probably benign 0.26
R4969:Wrap73 UTSW 4 154152681 missense probably damaging 1.00
R5254:Wrap73 UTSW 4 154155346 missense probably benign 0.00
R5334:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5428:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R5431:Wrap73 UTSW 4 154145274 missense probably damaging 0.97
R7338:Wrap73 UTSW 4 154152586 missense probably benign 0.26
R7426:Wrap73 UTSW 4 154156127 missense probably damaging 1.00
R7480:Wrap73 UTSW 4 154152586 missense probably benign 0.26
R7680:Wrap73 UTSW 4 154156622 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCTGCAAAGGGTCAGACTTG -3'
(R):5'- AGGCTTCACAGGAGAACACC -3'

Sequencing Primer
(F):5'- CTCCGTGTGGGGCACATAGATAG -3'
(R):5'- GAACACCTGCGGTCTCTACACTG -3'
Posted On 2017-01-03