Incidental Mutation 'R5728:Prss2'
ID452601
Institutional Source Beutler Lab
Gene Symbol Prss2
Ensembl Gene ENSMUSG00000057163
Gene Nameprotease, serine 2
SynonymsTRYP, Tesp4, Ta, TRY8, Try2
MMRRC Submission 043345-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5728 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location41521787-41525079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41523917 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 88 (V88A)
Ref Sequence ENSEMBL: ENSMUSP00000065393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070380]
Predicted Effect probably benign
Transcript: ENSMUST00000070380
AA Change: V88A

PolyPhen 2 Score 0.286 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000065393
Gene: ENSMUSG00000057163
AA Change: V88A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Tryp_SPc 23 239 5.29e-106 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the trypsin family of serine proteases and encodes anionic trypsinogen. It is part of a cluster of trypsinogen genes that are located within the T cell receptor beta locus. Enzymes of this family cleave peptide bonds that follow lysine or arginine residues. This protein is found at high levels in pancreatic juice and its upregulation is a characteristic feature of pancreatitis. This protein has also been found to activate pro-urokinase in ovarian tumors, suggesting a function in tumor invasion. In addition, this enzyme is able to cleave across the type II collagen triple helix in rheumatoid arthritis synovitis tissue, potentially participating in the degradation of type II collagen-rich cartilage matrix. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930018P22Rik T A 2: 104,122,868 M13K possibly damaging Het
Abca13 T A 11: 9,570,576 V4493D probably damaging Het
Ank1 A G 8: 23,122,767 probably null Het
B4galnt4 A G 7: 141,070,575 D785G probably benign Het
Chtop C T 3: 90,500,092 G187D probably damaging Het
Cnih1 A G 14: 46,780,191 F78S probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dcun1d4 T C 5: 73,520,148 F57L possibly damaging Het
Dgkz A G 2: 91,945,787 S44P possibly damaging Het
Dhps A G 8: 85,073,335 D138G probably damaging Het
Elp2 A G 18: 24,617,452 E282G probably damaging Het
Exoc6b T C 6: 84,860,191 Y342C probably damaging Het
Fasn A C 11: 120,813,513 S1386A probably benign Het
Foxj3 A T 4: 119,573,762 N111Y probably damaging Het
Gm5431 T C 11: 48,888,613 E772G probably damaging Het
Gpbar1 A G 1: 74,279,057 N153S probably damaging Het
Hspg2 T C 4: 137,542,766 I2345T possibly damaging Het
Igkv6-29 C A 6: 70,138,600 G70V possibly damaging Het
Lce1f A G 3: 92,719,345 S2P unknown Het
Lrrk2 A G 15: 91,774,974 D1863G probably benign Het
Lurap1 T C 4: 116,144,388 E36G possibly damaging Het
Lysmd3 A G 13: 81,669,261 E119G probably damaging Het
Map9 G A 3: 82,363,335 V69I probably benign Het
Mfsd4b2 A C 10: 39,923,795 F37C possibly damaging Het
Moxd1 A T 10: 24,223,683 H27L possibly damaging Het
Myo15 A T 11: 60,488,896 K1476N probably damaging Het
Mzf1 A G 7: 13,044,058 I552T probably benign Het
Nfatc2 A G 2: 168,480,249 V910A probably benign Het
Olfr666 C T 7: 104,893,229 R133Q possibly damaging Het
Rhbdf1 A G 11: 32,209,901 probably null Het
Slc10a4 A T 5: 73,012,334 Q434L probably damaging Het
Slc4a3 A G 1: 75,549,840 T2A probably benign Het
Sqor A G 2: 122,809,400 *194W probably null Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tagap1 A G 17: 6,957,021 V92A probably benign Het
Tiam2 A G 17: 3,414,956 Y320C probably damaging Het
Toporsl T C 4: 52,611,469 I454T probably benign Het
Ttc23l G T 15: 10,551,550 T30K possibly damaging Het
Ubap1l T C 9: 65,369,288 V24A probably benign Het
Unc13c A T 9: 73,558,956 S1810T probably benign Het
Vmn1r56 A T 7: 5,196,123 I165K probably benign Het
Wnt8b A G 19: 44,511,318 T169A possibly damaging Het
Wrap73 T C 4: 154,154,642 probably null Het
Wwc2 A G 8: 47,864,061 I703T unknown Het
Zfp354a T A 11: 51,070,605 C546S probably damaging Het
Other mutations in Prss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Prss2 APN 6 41524543 missense possibly damaging 0.54
R2009:Prss2 UTSW 6 41523976 missense probably damaging 0.97
R4471:Prss2 UTSW 6 41522846 missense probably damaging 0.97
R6193:Prss2 UTSW 6 41521820 missense unknown
R6243:Prss2 UTSW 6 41524453 missense probably benign 0.00
R7793:Prss2 UTSW 6 41524952 missense possibly damaging 0.56
R8463:Prss2 UTSW 6 41521805 start codon destroyed probably null
Z1177:Prss2 UTSW 6 41523880 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- GGTTGCTTAACCAGAAACTATCTACC -3'
(R):5'- ACTCACCACCATTGCTGAGG -3'

Sequencing Primer
(F):5'- AAACAGCTTCTCCTTTCACATTAC -3'
(R):5'- ACCATTGCTGAGGGTGTTGC -3'
Posted On2017-01-03