Incidental Mutation 'R0552:Zfp563'
ID45262
Institutional Source Beutler Lab
Gene Symbol Zfp563
Ensembl Gene ENSMUSG00000067424
Gene Namezinc finger protein 563
Synonymszinc finger protein, Zfp413
MMRRC Submission 038744-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0552 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location33089310-33106203 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33104685 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 85 (S85C)
Ref Sequence ENSEMBL: ENSMUSP00000118809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000131722] [ENSMUST00000140829]
Predicted Effect possibly damaging
Transcript: ENSMUST00000131722
AA Change: S85C

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118809
Gene: ENSMUSG00000067424
AA Change: S85C

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
ZnF_C2H2 197 219 9.88e-5 SMART
ZnF_C2H2 225 247 3.16e-3 SMART
ZnF_C2H2 253 275 5.81e-2 SMART
ZnF_C2H2 281 303 2.4e-3 SMART
ZnF_C2H2 309 331 1.82e-3 SMART
ZnF_C2H2 337 359 1.72e-4 SMART
ZnF_C2H2 365 387 4.54e-4 SMART
ZnF_C2H2 393 415 7.78e-3 SMART
ZnF_C2H2 421 443 3.63e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000140829
AA Change: S85C
SMART Domains Protein: ENSMUSP00000121678
Gene: ENSMUSG00000067424
AA Change: S85C

DomainStartEndE-ValueType
KRAB 4 61 5.45e-16 SMART
ZnF_C2H2 141 163 2.63e2 SMART
ZnF_C2H2 169 191 9.08e-4 SMART
Pfam:zf-C2H2_4 197 209 9.4e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000153072
AA Change: S125C
SMART Domains Protein: ENSMUSP00000119142
Gene: ENSMUSG00000067424
AA Change: S125C

DomainStartEndE-ValueType
low complexity region 30 41 N/A INTRINSIC
KRAB 45 102 5.45e-16 SMART
Meta Mutation Damage Score 0.1113 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam9 A T 8: 24,963,010 N760K probably benign Het
Akr1b10 A G 6: 34,392,985 T216A possibly damaging Het
Arsj A G 3: 126,439,344 R580G probably benign Het
C9 A T 15: 6,445,437 I26F probably damaging Het
Cacna2d1 A G 5: 16,328,043 E578G probably damaging Het
Clca4b C T 3: 144,916,775 V510I probably benign Het
Dab2 C T 15: 6,435,414 T561I possibly damaging Het
E430018J23Rik A T 7: 127,392,332 I161N possibly damaging Het
Gm4737 T A 16: 46,154,592 T141S probably benign Het
Golga5 A T 12: 102,484,493 E12D possibly damaging Het
Hsd17b12 A T 2: 94,043,935 F208I probably damaging Het
Inf2 A G 12: 112,612,574 probably benign Het
Kcnh3 T A 15: 99,229,456 W378R probably damaging Het
Klhdc8b G C 9: 108,449,223 R158G possibly damaging Het
Klhl41 G A 2: 69,670,210 R5Q probably benign Het
Lcn3 T C 2: 25,766,409 probably null Het
Mppe1 A G 18: 67,237,348 probably null Het
Muc20 G A 16: 32,793,930 A359V probably damaging Het
Myh14 T C 7: 44,613,681 D1765G probably damaging Het
Olfr1257 C T 2: 89,880,891 Q22* probably null Het
Olfr418 T C 1: 173,270,805 M210T probably benign Het
Olfr482 A G 7: 108,094,778 M264T probably benign Het
Pbrm1 T A 14: 31,035,959 L182Q probably damaging Het
Pde8a A G 7: 81,317,347 N412S probably benign Het
Phyh A G 2: 4,936,101 T271A probably damaging Het
Pkhd1l1 T C 15: 44,489,546 S258P probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Pyroxd1 A G 6: 142,345,737 E2G probably benign Het
Ralgapa1 G T 12: 55,676,765 Q2115K probably benign Het
Rufy3 A G 5: 88,584,270 E44G possibly damaging Het
Slit2 A T 5: 48,238,379 N712I probably damaging Het
Sptbn1 A G 11: 30,145,985 M303T possibly damaging Het
Ssbp4 A G 8: 70,599,859 I154T probably benign Het
Syne2 A G 12: 75,931,004 K1409E probably benign Het
Tfap2b T C 1: 19,234,225 Y420H probably damaging Het
Tlr5 A G 1: 182,975,696 probably null Het
Tmprss15 C T 16: 79,024,749 probably null Het
Tns1 A T 1: 73,920,563 I418N probably damaging Het
Txlna A T 4: 129,629,191 V452D probably benign Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Other mutations in Zfp563
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01629:Zfp563 APN 17 33104626 missense probably damaging 1.00
IGL01981:Zfp563 APN 17 33105409 missense probably benign 0.16
IGL02407:Zfp563 APN 17 33104821 missense probably benign 0.00
IGL02662:Zfp563 APN 17 33102279 missense probably damaging 1.00
IGL03220:Zfp563 APN 17 33104687 missense probably benign 0.44
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0241:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R0537:Zfp563 UTSW 17 33104685 missense possibly damaging 0.61
R1544:Zfp563 UTSW 17 33105213 missense probably benign 0.01
R3763:Zfp563 UTSW 17 33104928 nonsense probably null
R3979:Zfp563 UTSW 17 33105727 missense probably benign 0.03
R4938:Zfp563 UTSW 17 33105709 missense probably damaging 1.00
R5280:Zfp563 UTSW 17 33104838 missense probably damaging 0.99
R5383:Zfp563 UTSW 17 33104707 missense probably benign
R5485:Zfp563 UTSW 17 33089566 unclassified probably benign
R5524:Zfp563 UTSW 17 33102541 critical splice acceptor site probably null
R5567:Zfp563 UTSW 17 33089457 unclassified probably benign
R5736:Zfp563 UTSW 17 33104986 missense possibly damaging 0.91
R5758:Zfp563 UTSW 17 33104920 missense probably damaging 1.00
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6034:Zfp563 UTSW 17 33104961 missense probably damaging 0.96
R6532:Zfp563 UTSW 17 33105698 missense probably benign 0.21
RF007:Zfp563 UTSW 17 33105025 missense probably benign
X0023:Zfp563 UTSW 17 33105721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCACAGCAAGAAGCAAGACT -3'
(R):5'- AATGGTGTGGGTATTTCCATGTTTCAGA -3'

Sequencing Primer
(F):5'- GCATAATGGCATGGGCATTC -3'
(R):5'- CCATGTTTCAGATAGCACTCAGG -3'
Posted On2013-06-11