Mutagenetix > Incidental Mutations

Incidental Mutation 'R5729:Dgkd'

452633

Institutional Source

Beutler Lab

Gene Symbol

Dgkd

Ensembl Gene

ENSMUSG00000070738

Gene Name

diacylglycerol kinase, delta

Synonyms

dgkd-2, DGKdelta, AI841987, D330025K09

MMRRC Submission

043346-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.720) question?

Stock #

R5729 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87853287-87945180 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 87936332 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 90 (Q90*)

Ref Sequence

ENSEMBL: ENSMUSP00000139658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027517] [ENSMUST00000189448] [ENSMUST00000190061]

Predicted Effect

probably null
Transcript: ENSMUST00000027517
AA Change: Q917*

SMART Domains

Protein: ENSMUSP00000027517
Gene: ENSMUSG00000070738
AA Change: Q917*

Domain	Start	End	E-Value	Type
low complexity region	2	36	N/A	INTRINSIC
PH	54	148	1.7e-16	SMART
C1	164	213	2.48e-15	SMART
low complexity region	221	232	N/A	INTRINSIC
C1	236	286	8.56e-10	SMART
DAGKc	321	446	9.44e-62	SMART
low complexity region	691	710	N/A	INTRINSIC
DAGKa	765	922	1.25e-98	SMART
low complexity region	1128	1139	N/A	INTRINSIC
SAM	1148	1214	2.16e-22	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000185260
AA Change: Q105*

Predicted Effect

probably benign
Transcript: ENSMUST00000189448

SMART Domains

Protein: ENSMUSP00000139626
Gene: ENSMUSG00000070738

Domain	Start	End	E-Value	Type
low complexity region	82	93	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189726

Predicted Effect

probably null
Transcript: ENSMUST00000190061
AA Change: Q90*

SMART Domains

Protein: ENSMUSP00000139658
Gene: ENSMUSG00000070738
AA Change: Q90*

Domain	Start	End	E-Value	Type
DAGKa	1	95	7.6e-26	SMART
Blast:DAGKa	119	188	1e-23	BLAST
low complexity region	301	312	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.2%
20x: 95.2%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic enzyme that phosphorylates diacylglycerol to produce phosphatidic acid. Diacylglycerol and phosphatidic acid are two lipids that act as second messengers in signaling cascades. Their cellular concentrations are regulated by the encoded protein, and so it is thought to play an important role in cellular signal transduction. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are born with open eyelids and reduced body size, develop respiratory distress and die within 24 hrs of birth. Half of mice homozygous for a hypomorphic gene trap allele exhibit abnormal epileptic discharges and seizureswhile 9% of aging homozygotes develop tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adss	A	T	1: 177,796,258	V46E	possibly damaging	Het
Aldoart2	T	C	12: 55,565,905	V205A	probably benign	Het
Atp1a2	A	G	1: 172,293,371	S45P	probably damaging	Het
Atp4a	A	G	7: 30,712,426	K29E	possibly damaging	Het
AU040320	T	A	4: 126,830,415	D428E	probably damaging	Het
Bend7	T	C	2: 4,763,274	L347P	probably damaging	Het
Cacna2d1	T	A	5: 15,935,039	L9*	probably null	Het
Ccdc103	A	T	11: 102,883,078	I50F	probably damaging	Het
Cdc5l	T	C	17: 45,426,569	I88V	probably benign	Het
Cracr2a	T	C	6: 127,607,236	V86A	possibly damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Dnajc21	A	T	15: 10,449,596	D446E	probably benign	Het
Fam13a	T	G	6: 58,939,307	R648S	probably damaging	Het
Gabrg2	A	G	11: 41,967,623	V226A	probably damaging	Het
Gm5499	A	T	17: 87,078,516		noncoding transcript	Het
Gprc5c	G	T	11: 114,864,267	V257L	possibly damaging	Het
Irf2bp1	G	T	7: 19,005,247	E271*	probably null	Het
Krt86	T	G	15: 101,476,548	V274G	probably benign	Het
Lats2	A	T	14: 57,722,735	C151S	probably benign	Het
Mapk3	A	T	7: 126,764,807	T254S	probably benign	Het
Mat2b	A	T	11: 40,682,546	M202K	probably damaging	Het
Mos	A	G	4: 3,870,971	Y282H	probably benign	Het
Myo3b	A	G	2: 70,105,739	K108R	probably damaging	Het
Naa16	A	G	14: 79,355,780	Y417H	probably damaging	Het
Oat	A	T	7: 132,558,255	I412N	probably damaging	Het
Olfr1423	A	T	19: 12,035,908	I278N	probably damaging	Het
Pcdh1	A	T	18: 38,202,946	V73D	probably damaging	Het
Pigv	A	T	4: 133,664,823	Y345*	probably null	Het
Pitpnc1	G	T	11: 107,337,438	F34L	probably benign	Het
Plxnd1	A	G	6: 115,965,877	L1282P	probably damaging	Het
Ppp1r3a	T	C	6: 14,719,763	D384G	probably benign	Het
Ppp2ca	G	A	11: 52,118,029	E119K	probably damaging	Het
Psg29	A	T	7: 17,210,534	N323I	probably damaging	Het
Rasa4	T	C	5: 136,093,162	V108A	probably benign	Het
Rbm14	A	G	19: 4,802,549		probably benign	Het
Rfc1	A	T	5: 65,277,452	V657E	probably damaging	Het
Rhcg	A	T	7: 79,600,623	N237K	probably damaging	Het
Rpgrip1	A	G	14: 52,160,160	Q1302R	probably benign	Het
Rragc	A	G	4: 123,924,852	M287V	possibly damaging	Het
Scn7a	A	G	2: 66,741,957		probably null	Het
Sema6a	C	T	18: 47,281,343	C506Y	probably damaging	Het
Senp1	G	T	15: 98,066,531	H267Q	possibly damaging	Het
Skor2	A	G	18: 76,858,883	E100G	unknown	Het
Slc38a11	A	T	2: 65,317,021	C371S	probably benign	Het
Snai3	G	A	8: 122,454,890	A276V	probably benign	Het
Sp110	C	G	1: 85,589,118	E219D	probably damaging	Het
Spag6	C	T	2: 18,715,714	T99I	probably benign	Het
Spop	A	G	11: 95,485,849	I243V	possibly damaging	Het
Sra1	A	T	18: 36,667,443		probably benign	Het
Stag3	T	A	5: 138,290,223	S140T	possibly damaging	Het
Stx16	G	A	2: 174,093,499	G156R	probably damaging	Het
Tbc1d2b	G	C	9: 90,207,872	A868G	probably benign	Het
Tead2	A	G	7: 45,220,742		probably benign	Het
Tmem53	C	A	4: 117,268,472	H261N	probably damaging	Het
Ube4a	A	T	9: 44,933,329	S932T	probably damaging	Het
Usp9y	A	T	Y: 1,381,339	D827E	probably damaging	Het
Vmn2r53	T	C	7: 12,600,806	E309G	probably damaging	Het
Wrn	T	C	8: 33,268,778	S1026G	probably benign	Het
Zfp646	G	A	7: 127,885,454	A1760T	probably damaging	Het

Other mutations in Dgkd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01529:Dgkd	APN	1	87880411	missense	probably damaging	1.00
IGL01531:Dgkd	APN	1	87880411	missense	probably damaging	1.00
IGL01627:Dgkd	APN	1	87880428	missense	probably damaging	1.00
IGL01720:Dgkd	APN	1	87936765	missense	probably damaging	1.00
IGL01915:Dgkd	APN	1	87926058	missense	possibly damaging	0.86
IGL01941:Dgkd	APN	1	87924559	missense	probably damaging	0.99
IGL01951:Dgkd	APN	1	87916916	missense	probably damaging	1.00
IGL02244:Dgkd	APN	1	87915141	missense	probably benign	0.27
IGL02581:Dgkd	APN	1	87918002	splice site	probably benign
IGL02852:Dgkd	APN	1	87935413	missense	probably damaging	1.00
IGL02893:Dgkd	APN	1	87915208	splice site	probably benign
IGL03367:Dgkd	APN	1	87940308	critical splice donor site	probably null
R0014:Dgkd	UTSW	1	87881881	missense	probably damaging	1.00
R0016:Dgkd	UTSW	1	87917952	missense	probably benign	0.02
R0219:Dgkd	UTSW	1	87938274	splice site	probably benign
R0496:Dgkd	UTSW	1	87936900	missense	probably null	0.83
R0559:Dgkd	UTSW	1	87915104	missense	probably damaging	1.00
R0591:Dgkd	UTSW	1	87915104	missense	probably damaging	1.00
R1270:Dgkd	UTSW	1	87934125	missense	probably damaging	0.96
R1599:Dgkd	UTSW	1	87881886	missense	possibly damaging	0.58
R1658:Dgkd	UTSW	1	87926268	missense	probably damaging	1.00
R1745:Dgkd	UTSW	1	87932044	critical splice donor site	probably null
R1959:Dgkd	UTSW	1	87929827	missense	possibly damaging	0.47
R1960:Dgkd	UTSW	1	87929827	missense	possibly damaging	0.47
R2044:Dgkd	UTSW	1	87927691	missense	probably benign
R2148:Dgkd	UTSW	1	87881921	missense	probably damaging	1.00
R2232:Dgkd	UTSW	1	87929742	missense	probably benign	0.05
R2266:Dgkd	UTSW	1	87927818	unclassified	probably benign
R3774:Dgkd	UTSW	1	87936300	missense	probably damaging	1.00
R4004:Dgkd	UTSW	1	87935423	missense	possibly damaging	0.56
R4005:Dgkd	UTSW	1	87935423	missense	possibly damaging	0.56
R4133:Dgkd	UTSW	1	87941501	critical splice donor site	probably null
R4235:Dgkd	UTSW	1	87931982	nonsense	probably null
R4644:Dgkd	UTSW	1	87936294	missense	probably damaging	1.00
R4747:Dgkd	UTSW	1	87934167	missense	probably damaging	1.00
R4864:Dgkd	UTSW	1	87916838	missense	possibly damaging	0.94
R5334:Dgkd	UTSW	1	87938267	critical splice donor site	probably null
R5365:Dgkd	UTSW	1	87935416	missense	probably damaging	1.00
R5495:Dgkd	UTSW	1	87926872	missense	probably damaging	1.00
R5514:Dgkd	UTSW	1	87934110	missense	probably damaging	1.00
R5766:Dgkd	UTSW	1	87880449	nonsense	probably null
R6133:Dgkd	UTSW	1	87938240	missense	possibly damaging	0.93
R6137:Dgkd	UTSW	1	87936381	missense	possibly damaging	0.48
R6198:Dgkd	UTSW	1	87924208	missense	probably damaging	1.00
R6297:Dgkd	UTSW	1	87926144	missense	possibly damaging	0.94
R6577:Dgkd	UTSW	1	87940240	missense	probably damaging	1.00
R6846:Dgkd	UTSW	1	87925691	splice site	probably null
R6905:Dgkd	UTSW	1	87935375	missense	probably damaging	1.00
R7369:Dgkd	UTSW	1	87921622	missense	probably damaging	1.00
R7763:Dgkd	UTSW	1	87926949	missense	probably benign
R7921:Dgkd	UTSW	1	87924084	missense	probably damaging	0.98
R8087:Dgkd	UTSW	1	87916847	missense	probably damaging	1.00
R8119:Dgkd	UTSW	1	87917967	missense	possibly damaging	0.78
R8731:Dgkd	UTSW	1	87916813	missense	not run
Z1176:Dgkd	UTSW	1	87927810	missense	probably benign	0.05
Z1177:Dgkd	UTSW	1	87916886	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GACCCCTTTAGCCTGATATCCG -3'
(R):5'- ACAGGGCACACCACTATGTC -3'

Sequencing Primer
(F):5'- GATATCCGTATCTGTACCCAAGATC -3'
(R):5'- CAGCTAATCTCTGTATGGTGAAGAG -3'

Posted On

2017-01-03