Incidental Mutation 'R5729:Scn7a'
ID452639
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission 043346-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5729 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 66741957 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably null
Transcript: ENSMUST00000042792
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Meta Mutation Damage Score 0.9479 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss A T 1: 177,796,258 V46E possibly damaging Het
Aldoart2 T C 12: 55,565,905 V205A probably benign Het
Atp1a2 A G 1: 172,293,371 S45P probably damaging Het
Atp4a A G 7: 30,712,426 K29E possibly damaging Het
AU040320 T A 4: 126,830,415 D428E probably damaging Het
Bend7 T C 2: 4,763,274 L347P probably damaging Het
Cacna2d1 T A 5: 15,935,039 L9* probably null Het
Ccdc103 A T 11: 102,883,078 I50F probably damaging Het
Cdc5l T C 17: 45,426,569 I88V probably benign Het
Cracr2a T C 6: 127,607,236 V86A possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dgkd C T 1: 87,936,332 Q90* probably null Het
Dnajc21 A T 15: 10,449,596 D446E probably benign Het
Fam13a T G 6: 58,939,307 R648S probably damaging Het
Gabrg2 A G 11: 41,967,623 V226A probably damaging Het
Gm5499 A T 17: 87,078,516 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Irf2bp1 G T 7: 19,005,247 E271* probably null Het
Krt86 T G 15: 101,476,548 V274G probably benign Het
Lats2 A T 14: 57,722,735 C151S probably benign Het
Mapk3 A T 7: 126,764,807 T254S probably benign Het
Mat2b A T 11: 40,682,546 M202K probably damaging Het
Mos A G 4: 3,870,971 Y282H probably benign Het
Myo3b A G 2: 70,105,739 K108R probably damaging Het
Naa16 A G 14: 79,355,780 Y417H probably damaging Het
Oat A T 7: 132,558,255 I412N probably damaging Het
Olfr1423 A T 19: 12,035,908 I278N probably damaging Het
Pcdh1 A T 18: 38,202,946 V73D probably damaging Het
Pigv A T 4: 133,664,823 Y345* probably null Het
Pitpnc1 G T 11: 107,337,438 F34L probably benign Het
Plxnd1 A G 6: 115,965,877 L1282P probably damaging Het
Ppp1r3a T C 6: 14,719,763 D384G probably benign Het
Ppp2ca G A 11: 52,118,029 E119K probably damaging Het
Psg29 A T 7: 17,210,534 N323I probably damaging Het
Rasa4 T C 5: 136,093,162 V108A probably benign Het
Rbm14 A G 19: 4,802,549 probably benign Het
Rfc1 A T 5: 65,277,452 V657E probably damaging Het
Rhcg A T 7: 79,600,623 N237K probably damaging Het
Rpgrip1 A G 14: 52,160,160 Q1302R probably benign Het
Rragc A G 4: 123,924,852 M287V possibly damaging Het
Sema6a C T 18: 47,281,343 C506Y probably damaging Het
Senp1 G T 15: 98,066,531 H267Q possibly damaging Het
Skor2 A G 18: 76,858,883 E100G unknown Het
Slc38a11 A T 2: 65,317,021 C371S probably benign Het
Snai3 G A 8: 122,454,890 A276V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spag6 C T 2: 18,715,714 T99I probably benign Het
Spop A G 11: 95,485,849 I243V possibly damaging Het
Sra1 A T 18: 36,667,443 probably benign Het
Stag3 T A 5: 138,290,223 S140T possibly damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d2b G C 9: 90,207,872 A868G probably benign Het
Tead2 A G 7: 45,220,742 probably benign Het
Tmem53 C A 4: 117,268,472 H261N probably damaging Het
Ube4a A T 9: 44,933,329 S932T probably damaging Het
Usp9y A T Y: 1,381,339 D827E probably damaging Het
Vmn2r53 T C 7: 12,600,806 E309G probably damaging Het
Wrn T C 8: 33,268,778 S1026G probably benign Het
Zfp646 G A 7: 127,885,454 A1760T probably damaging Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7014:Scn7a UTSW 2 66741959 missense probably null 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
R7636:Scn7a UTSW 2 66743828 missense possibly damaging 0.67
R7685:Scn7a UTSW 2 66676192 missense probably damaging 1.00
R7711:Scn7a UTSW 2 66700877 missense probably damaging 1.00
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACTGGTTTCTTGGTGAAAGG -3'
(R):5'- TCATGGGAGCAAGGAATATCC -3'

Sequencing Primer
(F):5'- AGAATCTATCTCTGCTATCCATTGAG -3'
(R):5'- TCAAAGACCATGGGCTCA -3'
Posted On2017-01-03