Incidental Mutation 'R5729:Mos'
ID452642
Institutional Source Beutler Lab
Gene Symbol Mos
Ensembl Gene ENSMUSG00000078365
Gene NameMoloney sarcoma oncogene
Synonymsc-mos
MMRRC Submission 043346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5729 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location3870657-3872105 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3870971 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 282 (Y282H)
Ref Sequence ENSEMBL: ENSMUSP00000100789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105158]
Predicted Effect probably benign
Transcript: ENSMUST00000105158
AA Change: Y282H

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000100789
Gene: ENSMUSG00000078365
AA Change: Y282H

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
Pfam:Pkinase_Tyr 63 335 9e-41 PFAM
Pfam:Pkinase 64 334 6.3e-43 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MOS is a serine/threonine kinase that activates the MAP kinase cascade through direct phosphorylation of the MAP kinase activator MEK (MAP2K1; MIM 176872) (Prasad et al., 2008 [PubMed 18246541]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mutations that inactivate the gene result in female infertility and an increased susceptibility to tumors. Oocytes progress through meiosis II without arrest and undergo spontaneous parthenogenetic activation. Male mice are fertile and show no spermatogenic defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss A T 1: 177,796,258 V46E possibly damaging Het
Aldoart2 T C 12: 55,565,905 V205A probably benign Het
Atp1a2 A G 1: 172,293,371 S45P probably damaging Het
Atp4a A G 7: 30,712,426 K29E possibly damaging Het
AU040320 T A 4: 126,830,415 D428E probably damaging Het
Bend7 T C 2: 4,763,274 L347P probably damaging Het
Cacna2d1 T A 5: 15,935,039 L9* probably null Het
Ccdc103 A T 11: 102,883,078 I50F probably damaging Het
Cdc5l T C 17: 45,426,569 I88V probably benign Het
Cracr2a T C 6: 127,607,236 V86A possibly damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Dgkd C T 1: 87,936,332 Q90* probably null Het
Dnajc21 A T 15: 10,449,596 D446E probably benign Het
Fam13a T G 6: 58,939,307 R648S probably damaging Het
Gabrg2 A G 11: 41,967,623 V226A probably damaging Het
Gm5499 A T 17: 87,078,516 noncoding transcript Het
Gprc5c G T 11: 114,864,267 V257L possibly damaging Het
Irf2bp1 G T 7: 19,005,247 E271* probably null Het
Krt86 T G 15: 101,476,548 V274G probably benign Het
Lats2 A T 14: 57,722,735 C151S probably benign Het
Mapk3 A T 7: 126,764,807 T254S probably benign Het
Mat2b A T 11: 40,682,546 M202K probably damaging Het
Myo3b A G 2: 70,105,739 K108R probably damaging Het
Naa16 A G 14: 79,355,780 Y417H probably damaging Het
Oat A T 7: 132,558,255 I412N probably damaging Het
Olfr1423 A T 19: 12,035,908 I278N probably damaging Het
Pcdh1 A T 18: 38,202,946 V73D probably damaging Het
Pigv A T 4: 133,664,823 Y345* probably null Het
Pitpnc1 G T 11: 107,337,438 F34L probably benign Het
Plxnd1 A G 6: 115,965,877 L1282P probably damaging Het
Ppp1r3a T C 6: 14,719,763 D384G probably benign Het
Ppp2ca G A 11: 52,118,029 E119K probably damaging Het
Psg29 A T 7: 17,210,534 N323I probably damaging Het
Rasa4 T C 5: 136,093,162 V108A probably benign Het
Rbm14 A G 19: 4,802,549 probably benign Het
Rfc1 A T 5: 65,277,452 V657E probably damaging Het
Rhcg A T 7: 79,600,623 N237K probably damaging Het
Rpgrip1 A G 14: 52,160,160 Q1302R probably benign Het
Rragc A G 4: 123,924,852 M287V possibly damaging Het
Scn7a A G 2: 66,741,957 probably null Het
Sema6a C T 18: 47,281,343 C506Y probably damaging Het
Senp1 G T 15: 98,066,531 H267Q possibly damaging Het
Skor2 A G 18: 76,858,883 E100G unknown Het
Slc38a11 A T 2: 65,317,021 C371S probably benign Het
Snai3 G A 8: 122,454,890 A276V probably benign Het
Sp110 C G 1: 85,589,118 E219D probably damaging Het
Spag6 C T 2: 18,715,714 T99I probably benign Het
Spop A G 11: 95,485,849 I243V possibly damaging Het
Sra1 A T 18: 36,667,443 probably benign Het
Stag3 T A 5: 138,290,223 S140T possibly damaging Het
Stx16 G A 2: 174,093,499 G156R probably damaging Het
Tbc1d2b G C 9: 90,207,872 A868G probably benign Het
Tead2 A G 7: 45,220,742 probably benign Het
Tmem53 C A 4: 117,268,472 H261N probably damaging Het
Ube4a A T 9: 44,933,329 S932T probably damaging Het
Usp9y A T Y: 1,381,339 D827E probably damaging Het
Vmn2r53 T C 7: 12,600,806 E309G probably damaging Het
Wrn T C 8: 33,268,778 S1026G probably benign Het
Zfp646 G A 7: 127,885,454 A1760T probably damaging Het
Other mutations in Mos
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Mos APN 4 3871459 missense probably damaging 1.00
IGL01302:Mos APN 4 3871815 utr 5 prime probably benign
IGL01739:Mos APN 4 3871816 utr 5 prime probably benign
IGL01867:Mos APN 4 3870845 missense probably benign 0.33
IGL02647:Mos APN 4 3870961 missense probably damaging 1.00
PIT4418001:Mos UTSW 4 3870814 missense possibly damaging 0.86
R0967:Mos UTSW 4 3870932 missense probably benign
R4927:Mos UTSW 4 3871093 missense probably damaging 1.00
R6947:Mos UTSW 4 3871585 missense probably damaging 1.00
R8359:Mos UTSW 4 3871097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGCCTTGAGGTCCCTTTGG -3'
(R):5'- TTTGATCAGTGAGCAAGACGTTTG -3'

Sequencing Primer
(F):5'- TTGGAGCAGTTCTGCACC -3'
(R):5'- AAGATCAGTGACTTCGGCTGCTC -3'
Posted On2017-01-03